We narrowed to 16,648 results for: grn
-
Plasmid#229014PurposePerturb Seq lentiviral sgRNA vectorDepositorTypeEmpty backboneUseLentiviralAvailable SinceMay 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2
Plasmid#217635PurposeAAV backbone for sgRNA expression. Contains a Lox-flanked handle sequence for Cre-dependent PCR amplification of sgRNAs. Protospacer is cloned between BstXI and BlpI.DepositorInsertmU6-sgRNA, Handle sequence, EF1a-mTagBFP2
UseAAVPromoterEF1alpha and mU6Available SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSS2.1-Cas9-HH-gRNADhps-HDV
Plasmid#241015PurposeCas9 expression cassette encoding a guide RNA targeting the Dhps locus, flanked by a hammerhead (HH) ribozyme at the 5′ end and a hepatitis delta virus (HDV) ribozyme at the 3′ endDepositorInsertsCas9-Hammerhead (HH) Ribozyme-gRNA(Dhps)-Hepatitis Delta Virus (HDV) Ribozyme
blasticidin-S deaminase
ExpressionYeastAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK3/PERK_sgRNA
Plasmid#218666PurposesgRNA targeting human EIF2AK3/PERKDepositorInsertEIF2AK3 (EIF2AK3 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKVL2-U6gRNA_SAM(BbsI)-PGKpuroBFP-W
Plasmid#112925PurposeLentiviral vector for SAM-CRISPRa gRNA expression with puroBFPDepositorInserthU6 promoter, gRNA-SAM expression cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
v1em-Nterm-PE2max-U6-sgRNA
Plasmid#198732PurposeAAV genome encoding N-terminal PE2max and U6 expression cassetteDepositorInsertNterm PE2max-NpuN
UseAAVPromoterEFSAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWS3799-gRNA-Csy4-template
Plasmid#182827PurposeSpCas9 gRNA-Csy4 templateDepositorInsertSpCas9 gRNA scaffold + Csy4 sequence
UseCRISPRAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
HH-gRNA-HDV-Shuttle-Vector
Plasmid#169098PurposeBackbone plasmid to generate HH-gRNA-HDV segmentDepositorInsertHH-gRNAbackbone-HDV
ExpressionMammalianPromoterNAAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSEM253 - sgRNA mosTI hygroR
Plasmid#159827PurposeSingle copy or array insertion by MosTI using split hygroR selectionDepositorInsertsgRNA mosTI hygroR
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgRNA-CLTA-mCherry
Plasmid#240637PurposeVector for expressing an sgRNA targeting CLTA promoter from the mouse U6 promoter and a puromycin resistance cassette and mCherry from the EF1Alpha promoter.DepositorInsertpuro-T2A-mCherry
UseCRISPRExpressionMammalianAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9/VRQR-sgRNA (BbsI)
Plasmid#129725PurposeExpressing SpCas9/VRQR mutant and sgRNA for target sequence with NGA PAMDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA4-CTCF-3p-UTR
Plasmid#195106PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA3-CTCF-3p-UTR
Plasmid#195105PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDY0207 ACTB atgRNA with v1 scaffold
Plasmid#179107PurposeACTB N-term PBS 13 RT 29 Bxb1 AttB 46 atgRNADepositorInsertACTB N-term PBS 13 RT 29 AttB 46 atgRNA
UseCRISPRAvailable SinceFeb. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-tomato-TSC2-sgRNA
Plasmid#196195PurposeEditing human TSC2 locusDepositorInsertTSC2 (TSC2 Human)
UseCRISPRAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA-SV40-puro
Plasmid#240539PurposeLentiviral backbone plasmid to insert epegRNAs (tevopreq1) of interest with puromycin resistance. The cloning site is BsmBI.DepositorInsertepegRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMD19-PBBa_J23117-sgRNA-Spr
Plasmid#190793PurposeTemplate vector to amplify single sgRNAs or pieces for multiplexing arrays. Has flanking BsaI-sites.DepositorInsertsgRNA (dummy)
UseSynthetic BiologyExpressionBacterialPromoterBBa_J23117Available SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNTI661 pRPR1(TetO)-sgRNA
Plasmid#139475PurposeVector for tet-regulated sgRNA expression in yeastDepositorInsertsingle guide RNA scaffold
UseCRISPRExpressionYeastPromoterpRPR1(TetO)Available SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-sp-sgRNA-RNF2_+41nick
Plasmid#135958PurposeS. pyogenes sgRNA for +41 nick in RNF2DepositorInsertRNF2_+41 nicking sgRNA
ExpressionMammalianMutationSee manuscriptPromoterU6Available SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only