We narrowed to 16,106 results for: grna
-
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(AAVS1)-PGKpuroBFP-W
Plasmid#200506PurposeLentiviral vector expressing gRNA targeting human ARID1A and AAVS1DepositorAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(AAVS1)-hU6gRNA5(BbsI)-PGKpuroBFP-W
Plasmid#200502PurposeLentiviral vector expressing gRNA targeting human AAVS1DepositorInsertAAVS1 (AAVS1 Human)
UseLentiviralAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(AAVS1)-PGKpuroBFP-W
Plasmid#200503PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and AAVS1DepositorAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-evoCjCas9-ABE8e_gRNA
Plasmid#202561PurposehSyn-evoCjCas9-ABE8e and hU6-BsmBI-gRNA in AAV2 backbone (ITRs)DepositorInsertevoCjCas9-ABE8e
UseAAVAvailable sinceSept. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9(BspMI/SapI/BsaI_cassettes)-T7-gRNA1 (BPK1807)
Plasmid#223065PurposeDual pT7 entry plasmid for SpCas9(6AA) library; bacterial expression plasmid with type IIS RE cassettes around D1135/S1136, G1218/E1219, R1335/T1337 (precursor to MMW94). Expresses a gRNA.DepositorInsertentry vector for human codon opt. bacterial expr. plasmid for SpCas9(6AA_NNS) library, with gRNA targeting EGFP site 1
UseCRISPRTagsNLS(SV40)-3xFLAGExpressionBacterialMutationThree regions of SpCas9 encode type IIS restricti…PromoterDual T7Available sinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(NT)-PGKpuro2ABFP-W
Plasmid#163169PurposeLentiviral plasmid with non-targeting gRNA, co-expression of BFP tagDepositorInsertNon-targeting
UseCRISPR and LentiviralTagsBFPExpressionMammalianPromoterU6Available sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCfB3048(gRNA XII-2)
Plasmid#73290PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBluescript_VEGFA-TS3_SaCas9_sgRNA2
Plasmid#107330PurposeU6 driven SaCas9 sgRNA expression for VEGFA site 3DepositorInsertVEGFA-TS3 sgRNA
UseCRISPRPromoterU6Available sinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
UHMK1 gRNA (BRDN0001147576)
Plasmid#77184Purpose3rd generation lentiviral gRNA plasmid targeting human UHMK1DepositorAvailable sinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
LAMTOR3 gRNA (BRDN0001147669)
Plasmid#77136Purpose3rd generation lentiviral gRNA plasmid targeting human LAMTOR3DepositorAvailable sinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
CROT gRNA (BRDN0001145682)
Plasmid#77709Purpose3rd generation lentiviral gRNA plasmid targeting human CROTDepositorAvailable sinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
PDGFRL gRNA (BRDN0001145943)
Plasmid#77697Purpose3rd generation lentiviral gRNA plasmid targeting human PDGFRLDepositorAvailable sinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
KALRN gRNA (BRDN0001145005)
Plasmid#77639Purpose3rd generation lentiviral gRNA plasmid targeting human KALRNDepositorAvailable sinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
PHKA2 gRNA (BRDN0001146244)
Plasmid#77842Purpose3rd generation lentiviral gRNA plasmid targeting human PHKA2DepositorAvailable sinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
MKNK2 gRNA (BRDN0001147215)
Plasmid#77762Purpose3rd generation lentiviral gRNA plasmid targeting human MKNK2DepositorAvailable sinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
NPR2 gRNA (BRDN0001148355)
Plasmid#77753Purpose3rd generation lentiviral gRNA plasmid targeting human NPR2DepositorAvailable sinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
OXSR1 gRNA (BRDN0001147167)
Plasmid#77751Purpose3rd generation lentiviral gRNA plasmid targeting human OXSR1DepositorAvailable sinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAMK2B gRNA (BRDN0001148102)
Plasmid#77742Purpose3rd generation lentiviral gRNA plasmid targeting human CAMK2BDepositorAvailable sinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only