We narrowed to 16,712 results for: grna
-
Plasmid#121939PurposeCRISPR-Sirius plasmidDepositorInsertsgRNA-Sirius-8XMS2
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterhuman U6 promoterAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYES2-gRNA-hyg-MCS
Plasmid#107734PurposeE. coli-S. cerevisiae shuttle plasmid harbors gRNA expression cassettes targeting S. cerevisiae chromosomal X-3 site (HXK1 gene). Can function as a gRNA expression empty backbone plasmid.DepositorInsertX-3 site gRNA expression cassettes
UseCRISPRExpressionYeastPromoterSNR52pAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-tomato-TSC2-sgRNA
Plasmid#196195PurposeEditing human TSC2 locusDepositorInsertTSC2 (TSC2 Human)
UseCRISPRAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA4-CTCF-3p-UTR
Plasmid#195106PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA3-CTCF-3p-UTR
Plasmid#195105PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Simple-gRNA backbone
Plasmid#51306PurposegRNA expression plasmidDepositorTypeEmpty backboneUseCRISPR; Xenopus expressionPromoterT7Available SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
gRNA3_NIPBL_Cas9-hGem-for_N-terminal_tagging
Plasmid#217662Purposeexpresses Cas9-hGem and guideRNA for N terminal tagging of NIPBLDepositorInsertsgRNA3 for N terminal tagging of NIPBL (NIPBL Human)
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-8x-gRNA-eGFP
Plasmid#60718PurposeeGFP reporter containing 8 copies of a gRNA binding site for light-inducible dCas9 activationDepositorInsert8 copies of gRNA binding site (5'-AAAGGTCGAGAAACTGCAAA-3')
Available SinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK2/PKR_sgRNA
Plasmid#218527PurposesgRNA targeting human EIF2AK2/PKRDepositorInsertEIF2AK2 (EIF2AK2 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SunTag-FWAgRNA-4-22aa-TET1cd
Plasmid#106435PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the FWA promoterDepositorInsertgRNA4_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA-lib 2.0
Plasmid#89638PurposesgRNA expression in mammalian cells after Gateway cloningDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterhU6Available SinceFeb. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
psgRNA-GST-EGFP-GPIDAF
Plasmid#213719PurposeTo express a single-guide RNA under a U6 promoter, accompanied by the expression of the affinity sorting tag GST-EGFP-GPIDAF under a CMV promoter.DepositorInsertEGFP
UseCRISPRTagsGSTPromoterCMVAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR-U6-gRNA-TRE3G-TdTomato
Plasmid#192658PurposeA plasmid encoding TRE3G sgRNA and TRE3G-promoter-TdTomatoDepositorInsertTdTomato
ExpressionMammalianPromoterU6, TRE3GAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUF-Cas9-pre-sgRNA
Plasmid#137845PurposeCas9 and gRNA expression plasmid for P. falciparum with yDHODH selectable marker.DepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP
Plasmid#67991PurposeCRISPR gRNA expression vector with an improved l scaffold and puro/BFP markers without WPREDepositorInsertU6gRNA cassette with an improved scaffold, PGKpuro2ABFP cassette
UseCRISPR and LentiviralAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA-SV40-mCherry
Plasmid#240538PurposeLentiviral backbone plasmid to insert epegRNAs (tevopreq1) of interest with mCherry. The cloning site is BsmBI.DepositorInsertepegRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
U6-AsCas12f-full-length-sgRNA
Plasmid#204638PurposeExpression of full-length AsCas12f sgRNA in mammalian cellsDepositorInsertfull-length AsCas12f sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMS79 (eft-3p::Cas9 + sgRNA)
Plasmid#154839PurposeCas9 + sgRNA plasmid that is targeted to the synthetic guide sequence GGACAGTCCTGCCGAGGTGGDepositorInsertsgRNA
UseCRISPRExpressionWormAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2AmAG-W
Plasmid#67976PurposeCRISPR gRNA expression vector with an improved scaffold and puro/mAG markersDepositorInsertU6gRNA cassette, PGKpuro2AmAG cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only