We narrowed to 15,951 results for: grna
-
Plasmid#136419PurposeLentiviral expression of gRNAs targeting intron 1 of human CTBP2 and intron 1 of human MGMT. Also constitutively expresses Puromycin fused to TagBFP.DepositorInsertU6_sgRNA(CTBP2)_U6_sgRNA(MGMT)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, JAK2 sgRNA 1
Plasmid#70679PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic JAK2 amplicon-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against JAK2 amplicon found in AML-derived HEL cell line (JAK2 )
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRTagsExpressionMammalianMutationPromoterU6FAvailable sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
SauCas9KKH CCR5-nicking sgRNA
Plasmid#169863PurposeSauCas9KKH nicking sgRNA for CCR5DepositorInsertSauCas9KKH CCR5-nicking sgRNA
UseTagsExpressionMammalianMutationPromoterhuman U6 promoterAvailable sinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Vps39-g1)-PGKpuroBFP-W
Plasmid#105019PurposeLentiviral gRNA plasmid targeting mouse Vps39 , co-expression of TagBFPDepositorInsertVps39 (Vps39 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426-SNR52p-gRNA.clr-2.Y-SUP4t
Plasmid#89692PurposegRNA for clr-2 locusDepositorInsertgRNA for clr-2 locus
UseCRISPR; GrnaTagsNoExpressionMutationPromoterAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAC-U63-tgRNA-Rev
Plasmid#112811PurposegRNA cloning vector for expressing 2-6 gRNAs based on tgFE design in DrosophilaDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Stat3)-PGKpuroBFP-W
Plasmid#105027PurposeLentiviral gRNA plasmid targeting mouse Stat3 , co-expression of TagBFPDepositorInsertStat3 (Stat3 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pM117: VEGFA array presgRNA
Plasmid#166869PurposeU6-driven expression of human VEGFA targeting array presgRNA compatible with CasRx.DepositorInsertHuman VEGFA targeting array presgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gKAT7-5)-PGKpuro2ABFP-W
Plasmid#159287PurposeLentiviral vector expressing gRNA targeting KAT7 (gRNA ID. 5)DepositorInsertguide RNA targeting KAT7 (ID. 5) (KAT7 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhuman U6 promoterAvailable sinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNArodA
Plasmid#149656Purposeall-in-one CRISPRi vector for targeting B. burgdorferi rodADepositorInsertdCas9, lacI, sgRNArodA
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, PsynAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330 Mouse 5' Npm1 gRNA
Plasmid#127900PurposeWT Cas9 Vector targeting the 5' end of the mouse Npm1 geneDepositorInsertgRNA/Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Sa sgRNA expression vector
Plasmid#107720PurposeFor in vitro transcription of Sa sgRNA from the T7 promoter.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A2T
Plasmid#62258Purposeexpression of A2T sgRNA from the arabinose-inducible promoterDepositorInsertA2T sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, JAK2 sgRNA 2
Plasmid#70660PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic JAK2 amplicon-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against JAK2 amplicon found in AML-derived HEL cell line (JAK2 )
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cas9 ROSA sgRNA mCherry
Plasmid#155280PurposeLentiviral Cas9 expression, ROSA sgRNA expression, mCherry markerDepositorInsertspCas9
UseTagsExpressionMutationPromoterAvailable sinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA
Plasmid#68346PurposeUsed to produce AAV expressing the FlpO recombinase and pig gRNA towards 3 tumor suppressors: PTEN, p53 and SMAD4DepositorInserts3xgRNA;PTENA, p53B,SMAD4A
FlPO
UseAAV; Flp/frtTagsExpressionMammalianMutationPromoterCAG and U6Available sinceDec. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9n)-Eif4a1-L
Plasmid#122346PurposeExpresses sgRNA targeting mouse Eif4a1 and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Eif4a1
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCF820_U6-sgRNA-EF1a-mCherry2_lenti
Plasmid#138316PurposeLenti expression of mCherry2 with U6 promoter for SpyCas9 sgRNA targeting GFPDepositorInsertSpyCas9 GFP sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only