We narrowed to 11,503 results for: ENA
-
Plasmid#35500PurposeAAV expression of CaMKII-driven chimeric opsin variant C1V1 (E122T/E162T) for fast and potent optical excitation at red-shifted wavelengths.DepositorInsertChR1-VChR1 Chimera
UseAAVTagsmCherryExpressionMammalianMutationE122T and E162TPromoterCaMKIIaAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMIR-DsRed-IRES-His-Halo-Tev-Keap1
Plasmid#58240Purposeexpresses halo tagged human Keap1 proteinDepositorInsertKelch like ECH associated protein 1 (KEAP1 Human)
TagsHis-Halo-TevExpressionMammalianPromoterCMVAvailable SinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEntr1a-SspB-HaloTag-TIAM1-DHPH
Plasmid#176134PurposeHeterodimerization with iLID, Rac1 activationDepositorInsertTIAM1 (TIAM1 Human)
UseEntry vectorAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
hPlekhm1-dsRedM
Plasmid#73592PurposeExpress human Plekhm1 in mammalian cellsDepositorAvailable SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMGS56 (GFP-ARF16-PB1-P2A-OsTIR1)
Plasmid#129668PurposeA repair construct to express GFP-ARF16-PB1 and OsTIR1 under the control of the CMV promoter from the human AAVS1 locusDepositorInsertOsARF16-PB1 domain
TagsGFPExpressionMammalianAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pASK-mSAN1-Streptag
Plasmid#117165PurposeExpresses Strep-tagged murine SAN1 nuclease in bacteriaDepositorAvailable SinceOct. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Flag-hKlf4
Plasmid#20074DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pHD-SPARC2-S-LexA::p65
Plasmid#133564PurposeSwap out effector and terminator to generate SPARC2-S CRISPR-donor vector for CRISPR-HDR genomic insertion near the attP40 locusDepositorInsertLexA::p65
UseCRISPRExpressionInsectPromoter20X UASAvailable SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBR_attB(bxb)_ccdB_lox
Plasmid#183763PurposeBxb1-specific donor plasmid for the cloning of multiple inserts by Golden Gate assembly (BpiI)DepositorInsertccdB
UseCre/Lox and Synthetic BiologyExpressionMammalianAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAcFRS.1.t1
Plasmid#73545PurposetRNA synthetase/tRNA pair for the in vivo incorporation of several non-standard amino acids, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAcFRS.1.t1
pAcFRS.1.t1
ExpressionBacterialAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-SpdCas9-W3SL
Plasmid#210708PurposeThis Plasmid express hSyn promoter driven SpdCas9DepositorInsertS. Pyogenes dCas9
UseAAV and CRISPRTagsFLAGExpressionMammalianMutationD10A/H840APromoterhSynAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcs2-HRI-GFP-IRES-mCherry
Plasmid#226099PurposeHRI stability reporter construct for transient expression in mammalian cellsDepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAC_N_AURKB
Plasmid#111682PurposeMAC-tagged gene expressionDepositorInsertAURKB (AURKB Human)
ExpressionMammalianAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-Cezanne2 (OTU+UBA, aa 1-462)
Plasmid#61582PurposeExpresses human Cezanne2 (OTU+UBA domains) in E. coli.DepositorInsertCezanne2 (OTUD7A Human)
TagsHis6-GST-3CExpressionBacterialMutationIsoform 2. Deleted aa 463-933.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Neo-EF1A>Tet3G
Plasmid#184379PurposeThe Tet3G gene is expressed under a constitutive EF1-alpha promoter. This protein binds a TRE3G promoter to activate gene transcription only in the presence of tetracycline or its analogs (e.g. doxycycline)DepositorInsertTet3G
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hChR2(C128S/D156A)-EYFP
Plasmid#35501PurposeAAV expression of CaMKII-driven stabilized step function opsin (SSFO) for optogenetic activation.DepositorInserthChR2
UseAAVTagsEYFPExpressionMammalianMutationC128S and D156APromoterCaMKIIaAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
FUW-TetO-Esrrb
Plasmid#40798DepositorAvailable SinceOct. 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-3xFLAG-NLS-TPP1
Plasmid#53585PurposeMammalian expression of 3xFLAG tagged, nuclear localized TPP1, N-terminal.DepositorInsertTPP1 (ACD Human)
Tags3xFLAG and NLSExpressionMammalianMutationSilent mutation to eliminate PacI sitePromoterCMVAvailable SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2200
Plasmid#91082PurposeModule C, Promoter: none – to be combined with gRNA array in module B, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers (only works with pMOD_B2203), Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRPromoternone (will be fused to gRNA array in MODULE B)Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only