We narrowed to 14,239 results for: CAN
-
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-BAZ1B
Plasmid#65372PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER11 (miR-RUG)
Plasmid#44363PurposeInducible lentiviral gene silencing vector. Insert PheSGly294, (XhoI to EcoR1; 1.4kb), can be replaced w mir30 based hairpin of interestDepositorInsertPheS Gly294
UseLentiviralAvailable SinceAug. 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
p37-2iDMD-LR
Plasmid#88892Purpose37°C full-length DMD luc-red plasmid. Co-expresses human dystrophin, firefly luciferase and mCherry in mammalian cells. Plasmid carries phiC31 and Bxb1 attB sites and can be grown at 37°C.DepositorInsertsExpressionMammalianAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCK302
Plasmid#87768PurposeAs pCK301 (E. coli rhaBAD promoter upstream of sfGFP, sfGFP can be replaced with any gene of interest), but rhaS cloned downstream of ampR, which allows non-metabolisable inducer L-mannose to be usedDepositorInsertsPrhaBAD-sfGFP
rhaS from E. coli with its native RBS from E. coli
UseSynthetic BiologyTags6xHis TagExpressionBacterialPromoterPrhaBAD rhamnose-inducible promoter from E. coli …Available SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRD2
Plasmid#65376PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRD3
Plasmid#65377PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pInducer-YAP1-S127A/S397A
Plasmid#213585PurposeDoxycycline inducible expression of YAP1-S127A/S397A cDNA in mammalian cellsDepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRD7
Plasmid#65379PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCEFL_GPR161-HA
Plasmid#249268PurposeExpression of GPR161 wild typeDepositorAvailable SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBZCas13b
Plasmid#89898PurposeBacterial expression for bzCas13b, driven by the lac promoter, and DR-spacer-DR sequence driven by js23119. New spacer sequences can be cloned in between the DRs by digesting the plasmid with BsaI.DepositorInsertCas13b
ExpressionBacterialPromoterLacAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
Nluc CD63
Plasmid#242528PurposeThis plasmid can be used to quantify CD63 by luminescence signal upon providing substrate, in particular in the secretome, especially in the extracellular vesicles of cells expressing this construct.DepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRD9
Plasmid#65380PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
M22: pHR-SFFVp-NLS-iLID::EGFP::FTH1
Plasmid#122147PurposeSelf-assebled 24-mer tagged with NLS, iLID, and EGFP. Upon blue-light activation can bind up to 24 SspB-modified proteins.DepositorAvailable SinceMarch 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
SMARCA2-GFP
Plasmid#65390PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FuG-B2
Plasmid#67513PurposeThis is an envelope gene encoding plasmid to make retrogradely lentiviral vector. You can make type B2 envelope coating virus particle with HiRet by using this plasmid.DepositorInsertFusion Glycoprotein type B2
UseLentiviralTagsFusion protein of Vesicular stomatitis Indiana vi…PromoterCAGGSAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRDT
Plasmid#65381PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmTurquoise2-Golgi
Plasmid#36205PurposeIn vivo visualization of golgi apparatus (can be used for colocalization studies)DepositorAvailable SinceAug. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
GFP-BAZ1A
Plasmid#65371PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorInsertBAZ1A (BAZ1A Human)
TagsEmGFP and V5ExpressionMammalianMutation796I compared to all reference sequencesPromoterCMVAvailable SinceJune 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC2-A_sgBC2-C
Plasmid#154197PurposeLentiviral expression plasmid encoding two sgRNAs without a target. These can be used as a off-target control for CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC2-A, sgRNA-BC2-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only