We narrowed to 12,137 results for: NSI
-
Plasmid#113542PurposeProduces an N-terminal GST-tagged MePCE protein consisting of amino acids 400 - 689.DepositorAvailable SinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pGEX-5X-1_MePCE_aa1-400
Plasmid#113541PurposeProduces an N-terminal GST-tagged MePCE protein consisting of amino acids 1 - 400.DepositorAvailable SinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
DCT.VV.Orf139
Plasmid#12827PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf139
ExpressionMammalianAvailable SinceDec. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
pDGE Dicot Genome Editing Kit
Plasmid Kit#1000000084PurposeGolden Gate cloning-based assembly of constructs for CRISPR genome editing in dicotyledonous plants. Consists of "genome editing recipient" and "sgRNA shuttle" vectors.DepositorAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 2xFLAG-2xSTREP E2F6
Plasmid#236441Purposetransient overexpression of E2F6 in mammalian cellsDepositorAvailable SinceMay 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
polyQ74-GFP
Plasmid#231893PurposeForms cytosolic HTT partial exon 1 Q74 aggregatesDepositorInsertHTT partial exon 1 Q74 (HTT Human)
TagsEGFPExpressionMammalianMutationCAG repeat expansionAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW581
Plasmid#198818PurposeIn vivo calcium indicator. Presence of calcium (Ca2+) increases reporter signal intensity. Based on GCaMP7, improved SNR, fast kineticsDepositorInsert15xUAS::GCaMP7f-SL2-mKate2::let-858 3'UTR
ExpressionWormAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (WT)
Plasmid#196702PurposePlasmid for transient mammalian expression of wild type RNase H1 tagged with 2xNLS and EGFP that can be used to specifically degrade the nuclear R-loops.DepositorInserthuman RNaseH1 wild type
ExpressionMammalianAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.mRuby3
Plasmid#244092PurposeCytosolic expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsmRuby3Available SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pORTMAGE-4
Plasmid#72679PurposeExpresses Lambda Red recombinases and a dominant negative MutL allele all controlled by temperature sensitve cI857 repressor for high precision and efficiency MAGE experiments. Cam resistance marker.DepositorInsertmutL E32K
TagsnoneExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…Available SinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBOB-HA-Gnao1-A
Plasmid#245998PurposeExpress HA N-terminal tagged mouse GalphaoA transiently via transfection or stably via lentivirus-mediated infection in mammalian cells.DepositorAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(mem).iGlucoSnFR2.mRuby3
Plasmid#244097PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAzFRS.1.t1
Plasmid#73547PurposetRNA synthetase/tRNA pair for the in vivo incorporation of p-azido-l-phenylalanine, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAzFRS.1.t1
pAzFRS.1.t1
ExpressionBacterialAvailable SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
XZ393 (PB) EF1a-IL2Rbsp-FLAG-IL2Rb(ECD+TM)-TS-ADAR2dd-export-IRESv0-IL2Rgsp-3xHA-IL2Rg(ECD+TM)-TS-tdMCP-export
Plasmid#233388PurposePiggyBac donor plasmid with optimized IL-2-sensing eLIDAR receptor components separated by EMCV IRES, Puromycin resistance and BFP as markerDepositorInsertIL2Rb(ecto+TM)-ADAR2dd
TagsFLAGExpressionMammalianMutationE488Q, T501A on ADAR2ddPromoterEF1aAvailable SinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUW mCherry-GFP-LC3
Plasmid#110060PurposeTo visualize free autophagosomes (GFP and mCherry fluorescence) and autophagosomes that have fused with the lysosome (autolyosomes; mCherry fluorescence only, due to acid sensitivity of GFP)DepositorInsertmCherry-GFP-LC3
UseLentiviralAvailable SinceMay 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAzFRS.2.t1
Plasmid#73546PurposetRNA synthetase/tRNA pair for the in vivo incorporation of several non-standard amino acids, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAzFRS.2.t1
pAzFRS.2.t1
ExpressionBacterialAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMaRSC
Plasmid#89189PurposeThe pMaRS plasmid is the same construct as pMaRSL274G, but contains a T2A-Mcherry sequence appended to the C-terminal of L274GMmMetRS.DepositorInsertFlag-L274G-T2A-mCherry (Mars1 Mouse)
Available SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVX-SRRM2-mCherry
Plasmid#174089PurposeInducibly expresses SRRM2-mCherry in mammalian cells with the Tet-on systemDepositorAvailable SinceSept. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSL1521 (pSPIN, pSC101* backbone)
Plasmid#160729PurposeSingle-plasmid V. cholerae CAST system. Encodes all proteins, crRNA, donor DNA; non-targeting crRNA has BsaI sites for cloning. Temperature-sensitive pSC101* backbone can be cured by 37 °C incubation.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Flag-Axin1
Plasmid#109370PurposeTransient over-expression of human Axin1DepositorAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hSTING (V155M)
Plasmid#214161PurposeTransient expression of gain-of-function STING mutantDepositorAvailable SinceMarch 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti sfGFP-LAMP1-mCherry (pHLARE)
Plasmid#164478PurposeLysosomal pH biosensor consisting of sfGFP-rat Lamp1-mCherry. Plasmid for lentivirus production.DepositorInsertLAMP1 (Lamp1 Rat)
UseLentiviralTagsmCherry and superfolder GFPExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-mito-LAR-GECO1.2
Plasmid#61245PurposeExpresses LAR-GECO1.2 in the mitochondria in mammalian cellsDepositorInsertLAR-GECO1.2
Tagsa duplex of the mitochondrial targeting signal of…ExpressionMammalianMutationSubstitutions relative to R-GECO1.2: N45I/A47R/E1…PromoterCMVAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA HA DUSP6
Plasmid#236430Purposetransient overexpression of DUSP6 in mammalian cellsDepositorInsertDUSP6 (DUSP6 Human)
ExpressionMammalianAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
CoV2-M-IRES-E
Plasmid#177938PurposeTransient mammalian expression of codon optimized SARS-CoV-2 Membrane and Envelope proteins (original Wuhan Hu1 sequence). Used for generating RNA packaging virus-like particles.DepositorExpressionMammalianAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPW3758 : CMVd3-HsIRE1-HaloTag
Plasmid#185680PurposeLow-level transient expression of full-length HsIRE1 with a C-terminal HaloTag.DepositorInsertERN1 (ERN1 Human, Synthetic)
ExpressionMammalianAvailable SinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAcFRS.2.t1
Plasmid#73544PurposetRNA synthetase/tRNA pair for the in vivo incorporation of several non-standard amino acids, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAcFRS.2.t1
pAcFRS.2.t1
ExpressionBacterialAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HRE-dUnaG
Plasmid#124372PurposeUnaG fluorescent protein reporter for hypoxia-induced factor (HIF) signalingDepositorInsertHRE-dUnaG
UseLentiviralTagsPEST-degron and Myc tagPromoterHRE (HIF responsive element 5x + CMV minimal prom…Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hSTING (N154S)
Plasmid#214160PurposeTransient expression of gain-of-function STING mutantDepositorAvailable SinceMarch 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(mem).iGlucoSnFR2.mRuby3
Plasmid#244101PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-ER-LAR-GECO1
Plasmid#61244PurposeExpresses LAR-GECO1 in the endoplasmic reticulum in mammalian cellsDepositorInsertLAR-GECO1
TagsER-retention sequence: KDEL and ER-targeting sequ…ExpressionMammalianMutationSubstitutions relative to R-GECO1: V51W/I113V/N35…PromoterCMVAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pORTMAGE-3
Plasmid#72678PurposeExpresses Lambda Red recombinases and a dominant negative MutL allele all controlled by temperature sensitve cI857 repressor for high precision and efficiency MAGE experiments. Kan resistance marker.DepositorInsertmutL E32K
TagsnoneExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…Available SinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hSTING (S366A)
Plasmid#214155PurposeTransient expression of STINGDepositorAvailable SinceMarch 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
CoV2-Spike-D614G
Plasmid#177960PurposeTransient mammalian expression of codon optimized SARS-CoV-2 Spike protein (original Wuhan Hu1 sequence + D614G mutation)DepositorInsertSARS-CoV-2 Spike protein (original Wuhan Hu1 sequence + D614G mutation) (S )
ExpressionMammalianMutationD614GAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 HA E2F1
Plasmid#236431Purposetransient overexpression of E2F1 in mammalian cellsDepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(cyto).iGlucoSnFR2.mIRFP670nano3
Plasmid#244072PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsmIRFP670nano3Available SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHcRed-NPM1c-C1
Plasmid#131821PurposeExpresses HcRed-NPM1c (cytoplasmic mutant, human) in mammalian cells through transient transfectionDepositorInsertNPM1 (NPM1 Human)
TagsHcRedExpressionMammalianMutationThis is the cytoplasmic mutant causing AML, where…Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Luc-PS9
Plasmid#177942PurposeTransient mammalian expression of Luc2 (firefly luciferase) along with SARS-CoV-2 sequence 20080-21171 (PS9) within the 3'UTR. Resulting transcript is packaged into SARS-CoV-2 virus-like particles.DepositorInsertLuc2 (ORF1ab )
ExpressionMammalianAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only