We narrowed to 14,622 results for: transfer
-
Plasmid#118292PurposeExpresses human mutant DCX tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells. Serine at position 306 substituted for aspartic acidDepositorInsertDoublecortin (DCX Human)
UseAAVTags2A peptide and mCherryExpressionMammalianMutationSerine 306 changed to Aspartic AcidPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DCX(S306A)-2A-mCherry
Plasmid#118291PurposeExpresses human mutant DCX tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells. Serine at position 306 substituted for alanineDepositorInsertDoublecortin (DCX Human)
UseAAVTags2A peptide and mCherryExpressionMammalianMutationchanged Serine 306 to AlaninePromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-NOS-IN133.3xFLAG.mCherry-WPRE
Plasmid#127868PurposepAAV plasmid expressing an NOS-IN133.3xFLAG.mCherry fusion protein under the hSyn promoterDepositorInsertNos1 (Nos1 Mouse)
UseAAVTags3xFLAG and mCherryMutationAmino acids 1-133 onlyPromoterhSynAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-NLC-DHFR-SpCas9
Plasmid#124523PurposeExpresses SpCas9 fused to DHFR domains on both the N- and C- termini and an internal loop in mammalian cellsDepositorInsertNLC-DHFR-SpCas9
UseAAVTagsDestabilized domain of E.coli dihydrofolate reduc…ExpressionMammalianPromoterCbhAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40
Plasmid#98931PurposeCre dependent AAV expression of glutamate sensor from human synapsin promoter. ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorHas ServiceAAV1 and AAV5InsertiGluSnFr
UseAAVExpressionMammalianPromoterhSynAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-GFAP-iGABASnFR2n-WPRE
Plasmid#218872PurposeAAV-mediated expression of improved GABA sensor (negative change in fluorescence)DepositorInsertiGABASnFR2n
UseAAVExpressionMammalianMutationS99A F104H R168PPromoterGFAPAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEMS1977
Plasmid#49109PurposeAAV plasmid with C8ORF46 (Ple251) promoter driving expression of iCre.DepositorInsertssAAV-Ple251-icre
UseAAVExpressionMammalianPromoterC8ORF46Available SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-EF1a-PGD2-1.1
Plasmid#214764PurposeAAV packaging plasmid for GRAB PGD2-1.1 fluorescent sensor under EF1alpha promoterDepositorInsertGRAB-PGD2-1.1 sensor
UseAAVPromoterEF-1-alpha promoterAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTMB400_ZFcharm_Prnp_DPM
Plasmid#220847PurposeAAV genome expressing ZFcharm targeting Prnp; double perfect match self-silencing binding siteDepositorInsertZFcharm
UseAAVTagsHAtagExpressionMammalianMutationN/APromoterEFSAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTMB399_ZFcharm_Prnp_SPM
Plasmid#220846PurposeAAV genome expressing ZFcharm targeting Prnp; single perfect match self-silencing binding siteDepositorInsertZFcharm
UseAAVTagsHAtagExpressionMammalianMutationN/APromoterEFSAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{ChETA}on-WPRE
Plasmid#111387PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection) and Cre-ON ChETA (for optogenetic activation)DepositorAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 gfaABC1D-BioID2-BioID2-Kir4.1-HA
Plasmid#176746PurposeExpresses Kir4.1 fused with BioID2 at the N-terminus in astrocytesDepositorInsertHA-BioID2-BioID2-Kir4.1 (Kcnj10 Rat, Aquifex aeolicus)
UseAAVTagsHAExpressionBacterialPromotergfaABC1DAvailable SinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C entry vector
Plasmid#111752PurposeIntermediate vector containing HTT gene, except for polyQ region. Used to clone various polyQ lengths into HTT sequence with C-term FLAG tag. Baculovirus transfer vector for insect and mammalian cellsDepositorTypeEmpty backboneUseBaculovirus expressionTagsFLAGExpressionMammalianAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP15-AAV-H1/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82701PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
Plasmid#165493PurposeNeuronal expression of PACmn with dark Venus, a photoactivatable adenylyl cyclase derived from bPAC, membrane-anchored, no/reduced dark activityDepositorInsert2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
UseAAVTagsdarkVenusExpressionMammalianPromoterCaMKIIAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-short Cre-on G/W
Plasmid#86949PurposeGateway destination transfer plasmid for making AAV. Contains a DIO cassette for cre-induction. For introducing large constructs into AAVDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceApril 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-mScarlet-I-Cdt1
Plasmid#191100PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsertmScarlet-I-Cdt1 (30-120)
UseAAV and Synthetic BiologyTagsmScarlet-I fused to residues 30-120 of human Cdt1…ExpressionMammalianMutationOptimized to human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEMS1996
Plasmid#49126PurposeAAV plasmid with UGT8 (Ple267) promoter driving expression of iCre.DepositorInsertssAAV-Ple267-iCre
UseAAVExpressionMammalianPromoterUGT8Available SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-hSyn-mCherry.3xFLAG.NOS1AP-S-WPRE
Plasmid#127867PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1AP-S fusion protein under the hSyn promoterDepositorInsertNos1ap (Nos1ap Human, Mouse)
UseAAVTags3xFLAG and mCherryMutationconstructed by blunt end fusion of the 5’ 51 nucl…PromoterhSynAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC814 - pAAV-SYN1-CRTsigpep-GCaMP3 (D324G+D360G+397G+D435G 10.19)-KDEL
Plasmid#63887PurposeAn AAV packaging vector that expresses ER-retained low-affinity GCaMP3 variant under control of the SYN1 promoter.DepositorInsertER-localized low-affinity GCaMP3(10.19)
UseAAVPromoterhuman SYN1Available SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEMS2157
Plasmid#70118PurposePromoterless AAV plasmid with MCS to insert promoter for expression of EmGFP. Contains WPRE.DepositorInsertssAAV-MCS-EmGFP-WPRE
UseAAVExpressionMammalianPromoterPromoterlessAvailable SinceMay 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn1 CaRhAC T2A tDimer
Plasmid#101722Purpose- humanized - variant of pAAV hSyn YFP-CaRhAC Addgene # 101721– less reliable in hippocampal neuronsDepositorInsertsCatRhAC
red fluorescent protein
UseAAVMutationE497K,C569DPromoterhuman Synapsin1 promotor and ribosomal skip seque…Available SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
HT116_pAAV_hSyn-DiO-SomQuasAr6b_EGFP
Plasmid#190879PurposeCre-on expression of soma-targeted QuasAr6b under an neuronal promoterDepositorInsertsoma-targeted QuasAr6b
UseAAVTagsEGFPPromoterhSynAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.FAPdL5-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105982PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular dL5 FAP fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-FAPdL5-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsFAPdL5-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CCre-MBP4-WPRE
Plasmid#193919PurposeExpresses one of the components of Cre-DOR_N5C4 (RFP-dependent Cre)DepositorInsertCCre-MBP4
UseAAV, Affinity Reagent/ Antibody, Cre/Lox, and Syn…ExpressionMammalianPromoterEF1aAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-NCre-MBP5-WPRE
Plasmid#193918PurposeExpresses one of the components of Cre-DOR_N5C4 (RFP-dependent Cre)DepositorInsertNCre-MBP5
UseAAV, Affinity Reagent/ Antibody, Cre/Lox, and Syn…ExpressionMammalianPromoterEF1aAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAC8_PH-GST-Nter-GWs-Lox (VE5586)
Plasmid#163766PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter GST tag under the pH promoter.DepositorInsertN-terminal GST tag
TagsGST TagExpressionInsectPromoterPHAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV2_hSyn_Phobos_Citrine
Plasmid#98216PurposeBlue-shifted artificial anion conducting channelrhodopsin (aACR). Activation max 466 nm; off-kinetics 10 ms. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Phobos gene
UseAAVTagsCitrineExpressionMammalianMutationT59S, E83N, E90Q, E101S, V117R, E123S, T159G, G16…Promoterhuman synapsinAvailable SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only