We narrowed to 14,352 results for: Cas9
-
Plasmid#164160PurposeIncQ BHR plasmidDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
pUC19, containing H2-Kb c57/BL6 WK9
Plasmid#102641PurposeEncodes sequence of the murine H2-Kb alleleDepositorInsertH2-Kd Balb/c
Available sinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDD372
Plasmid#91824PurposeCodon-optimized GFP donor for the SapTrap cloning systemDepositorInsertGFP-C1
UseCRISPRExpressionWormAvailable sinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
th-P2A-Gal4 donor
Plasmid#65563PurposeIntron targeting-mediated Gal4 knockin at the zebrafish th locus.DepositorAvailable sinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGY18
Plasmid#221708PurposeEmpty Cas9 vector for multiplex gene editing in fungiDepositorTypeEmpty backboneUseCRISPR; AspergillusExpressionBacterialAvailable sinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRGEB34
Plasmid#158152PurposeConstruction of inPTG-Cas9 plasmids with a truncated 5'-UTR intron for plant genome editingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable sinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd (no NLS) SUP
Plasmid#115490PurposeCRISPR-Cas9 SunTag system to target NtDRMcd (without an NLS) to the SUPERMAN locus with two guide RNAsDepositorInsertg2_U6_g1_U6_NOS_NLS_GB1_noNLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYTK-DN3
Plasmid#180284PurposeSpacer cassette (TU2)DepositorInsertConL1 - Spacer - ConR2
ExpressionBacterialAvailable sinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCPH2A.X_S139D-GS3
Plasmid#204748PurposeExpression of Cas9 and human H2AX with the S139D mutationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertH2AX S139D (H2AX Human)
ExpressionMammalianMutationH2AX with the S139D mutationAvailable sinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
TU6m-gRNAscaffHygroR
Plasmid#165485PurposeS. pyogenes Cas9 guide RNA expression in tilapia cellsDepositorTypeEmpty backboneUseCRISPRPromoterOreochromis mossambicus U6Available sinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Cerulean-zhang2.0 Weiss full
Plasmid#79383PurposeCas9 gRNA variant to recruit ms2 proteinsDepositorInsertZhang 2.0 + scaffold
UseCRISPR and LentiviralExpressionMammalianAvailable sinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
BFP Homology Donor
Plasmid#149372PurposePromoter-less BFP cDNA with two homology arms to the lenti-CDDR reporter for HDR detectionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCDDR BFP Homology Donor
ExpressionMammalianAvailable sinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR1265
Plasmid#111094Purposelentiviral cDNA expression vector: plenti-x1-neo-linker-IRES-Thy1.1DepositorTypeEmpty backboneUseLentiviralAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAdSh.U6.gRNAS1
Plasmid#58252PurposeU6 promoter-driven single guide RNA complementary to the human AAVS1 locusDepositorInsertU6.gRNAS1 cassette
UseAdenoviral and CRISPRExpressionMammalianAvailable sinceSept. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCfB6684
Plasmid#106154PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6631, integration into Yarrowia lipolytica chromosomal location IntD_1, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable sinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LBJJ382
Plasmid#117518PurposeAlso known as LBJJ429. PCR template for sgRNA-EF with polyT, 67bp or 192bp terminatorDepositorInsertBpiI:ACTA:pU6-26:sgRNA-EF:t192bp:TTAC:BpiI
UseCRISPRExpressionPlantPromoterAtU6-26Available sinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1_Tet-inducible Luciferase reporter
Plasmid#64161PurposePhotoactivatable transcription system. Mammalian expression of sgRNA1 to target Tet-inducible-luciferase reporter.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA1 for Tet-inducible Luciferase reporter
UseCRISPRExpressionMammalianPromoterhuman U6Available sinceJune 23, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJA54
Plasmid#60212Purposecleavage near e1350 locus in sqt-1DepositorInsertsqt-1(e1350) gRNA1
UseCRISPRPromoterU6Available sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pROS12
Plasmid#107926Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by