We narrowed to 6,241 results for: cas9 expression plasmid
-
Plasmid#72250PurposeHuman expression plasmid for SpCas9-VQR-HF1 variant: CMV-T7-humanSpCas9-VQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, R1335Q, T1337R)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 VQR-HF1(N497A/R661A/Q695A/Q926A/D1135V/R1335Q/T1337R)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926A, D1135V, R1335Q, and T…PromoterCMVAvailable sinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAS1yl
Plasmid#73226PurposeConstitutive expression of Cas9 and sgRNA in Yarrowia lipolytica cellsDepositorInsertsCas9
sgRNA
UseCRISPR; In y. lipolyticaTagsExpressionBacterialMutationPromoterunknownAvailable sinceJune 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP977
Plasmid#65774PurposeHuman expression vector for SpCas9 D1135E variant: CMV-T7-humanSpCas9(D1135E)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135E)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135E mutation in Cas9PromoterCMV & T7Available sinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
HCP8
Plasmid#166110PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets the C-terminus of Whi5DepositorInsertWhi5-sg106 (WHI5 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 probasin_mTQ2_FlpO
Plasmid#68405PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex8 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2
FlpO
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianMutationPromoterSynthetic Probasin ARRx2 and U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pML104
Plasmid#67638PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains URA3 marker for yeast transformationDepositorInsertsCas9
single guide RNA expression cassette
UseCRISPRTagsExpressionYeastMutationPromoterpSNR52 and pTDH3Available sinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pML107
Plasmid#67639PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains LEU2 marker for yeast transformationDepositorInsertsCas9
single guide RNA expression cassette
UseCRISPRTagsExpressionYeastMutationPromoterpSNR52 and pTDH3 (aka GAP promoter)Available sinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC19-EAMP
Plasmid#138265PurposemCherry acceptor plasmid with iCas9 target site upstream of mCherry to be used in plasmid to plasmid integration reporter assay.DepositorInsertiCas9 target-mCherry
UseCRISPRTagsExpressionMammalianMutationPromoterEF1a-HTLVAvailable sinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXPR_047
Plasmid#107145Purposemeasures Cas9 activityDepositorInsertGFP + sgRNA for GFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pORFE0001
Plasmid#112070PurposeAtCas9 module CDS1DepositorInsertAtCAS9
UseCRISPRTagsExpressionPlantMutationPlant codon optimized Cas9 S. pyogenesPromoterAvailable sinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEcgRNA
Plasmid#166581PurposeCRISPR-Cas9-assisted genome editing in Escherichia coliDepositorInsertccdB
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKIR1.1
Plasmid#85758PurposeCRISPR/Cas9 in Arabidopsis with seed a fluorescent reporterDepositorInserthuman-codon-optimized SpCas9
UseCRISPRTagsFLAGExpressionPlantMutationPromoterAtRPS5AAvailable sinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVT36b
Plasmid#184437PurposeCRISPR/Cas9 plasmid, containing ScARS, IoURA3, iCas9, RPR1’-tRNA_Leu promoter, and sgRNA scaffoldDepositorTypeEmpty backboneUseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
HCP9
Plasmid#166111PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets the C-terminus of Hta2DepositorInsertHta2-sg18 (HTA2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV Retrograde)
Viral Prep#112677-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)Available sinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV5)
Viral Prep#112677-AAV5PurposeReady-to-use AAV5 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)Available sinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV1)
Viral Prep#112677-AAV1PurposeReady-to-use AAV1 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)Available sinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV8)
Viral Prep#112677-AAV8PurposeReady-to-use AAV8 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)Available sinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV9)
Viral Prep#112677-AAV9PurposeReady-to-use AAV9 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)Available sinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV2)
Viral Prep#112677-AAV2PurposeReady-to-use AAV2 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)Available sinceJan. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA2-MpCKB
Plasmid#238528PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKB
Plasmid#238527PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKA
Plasmid#238526PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 alphaDepositorInsertMpCKA
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458M-53BP1-DN1S
Plasmid#131045PurposePlasmid encoding Cas9-53BP1-DN1S fusion with BbsI restriction sites for insertion of guide RNA sequence.DepositorInsertSpCas9-53BP1-DN1S (TP53BP1 Human)
UseCRISPRTagsGFP and SpCas9ExpressionMammalianMutationOnly expressing residues 1231-1644 of complete 53…PromoterCBHAvailable sinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 1
Plasmid#51760PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 2
Plasmid#51761PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 4
Plasmid#51763PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 4
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 3
Plasmid#51762PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 3
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 6
Plasmid#51765PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 6
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTetO-hOSK-CASH-1
Plasmid#188977PurposeA CASH-1 GSH targeting, doxycycling inducible humanized Oct4, Sox2, and Klf4 expressing CRISPR/Cas9 donor plasmid.DepositorInsertDoxycycline inducible reprogramming donor cassette
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-S12
Plasmid#84031PurposeTo episomally express codon optimized Cas9 and chimeric guide RNADepositorInsertshSpCas9
eGFP
UseTags3x FLAGExpressionMammalianMutationPromoterCMV and CMV (downstream of F2A self-cleaving pept…Available sinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCB-CBEv2
Plasmid#221139PurposeCoxiella burnetii CRISPR-Cas9 cytosine base editing plasmid version 2 without sgRNA construct. Expresses 3xF-BE4-PpAPOBEC1(H122A).DepositorInsert3xF-PpAPOBEC1(H122A)-Cas9n-UGI-UGI (BE4-PpAPOBEC1(H122A))
UseCRISPRTags3xFLAGExpressionBacterialMutationPromoterlacIq-PtacAvailable sinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCB-CBEv1
Plasmid#221138PurposeCoxiella burnetii CRISPR-Cas9 cytosine base editing plasmid version 1 without sgRNA construct. Expresses 3xF-HF-BE3.DepositorInsert3xF-rAPOBEC1-Cas9n(HF)-UGI (HF-BE3)
UseCRISPRTags3xFLAGExpressionBacterialMutationPromoterlacIq-PtacAvailable sinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AP568-3
Plasmid#70048Purposeco-expression of Cas9 and crRNA 589 target sequenceDepositorInsertsgRNA for dpy‐10
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP568-2
Plasmid#70047Purposeco-expression of Cas9 and crRNA 589 target sequenceDepositorInsertsgRNA for dpy‐10
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSP571
Plasmid#139498PurposeCRISPR-Cas9 plasmid to generate double strand break in STL1 locus in S. cerevisiae. Expresses both Cas9 and STL1 sgRNADepositorInsertpGPD Cas9 / sgRNA (STL162)
UseTagsExpressionYeastMutationWTPromoterpGPDAvailable sinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGxxFP
Plasmid#50716Purpose5’ and 3’ EGFP fragments that shares 482bp were placed under ubiquitous CAG promoter. Used for validation of gRNA sequences by DSB mediated EGFP reconstitution.DepositorInsertsplit EGFP
UseCRISPRTagsExpressionMammalianMutationPromoterCAGAvailable sinceFeb. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPtGE34
Plasmid#107932PurposeExpresses Cas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
UseCRISPR and Synthetic Biology; Episomal vector for…TagsExpressionMutationPromoterAvailable sinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only