We narrowed to 11,430 results for: crispr cas9 expression plasmids
-
Plasmid#109358PurposeMammalian vector for expressing effector domains fused to dCas9.DepositorTypeEmpty backboneUseCRISPRTagsdCas9, SV40 NLS, 3xFLAGExpressionMammalianPromoterCMVAvailable SinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-dCas9-10xGCN4_Hygro
Plasmid#192651Purpose3rd generation lenti vector encoding dCas9-10xGCN4 (Suntag) with 2A Hygro resistance markerDepositorInsertdCas9-10xGCN4
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1aAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSMVP-Cas9FL-P2A-turboGFP
Plasmid#80941PurposePlasmid that expresses Cas9FL in mammalian cells; co-expresses turboGFP.DepositorInsertCas9FL
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSMVP-Cas9C-P2A-turboGFP
Plasmid#80935PurposePlasmid that expresses Cas9C in mammalian cells; co-expresses turboGFP.DepositorInsertCas9C
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
1255_pAAV-U6-SA-BbsI-MluI-gRNA-CB-SACas9-HA-OLLAS-spA
Plasmid#109320PurposePlasmid for AAV SaCas9 Mammalian Expression with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-NLS-SaCas9-NLS-3xHA-bGHpA-U6-BsaI-sgRNA
Plasmid#218710PurposeAAV vector plasmid expressing Cas9 from Staphylococcus aureus (SaCas9) under the human synapsin (SYN) promoter and its sgRNA under the U6 promoterDepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJUMP18-dCas9_O
Plasmid#127028PurposeBasic Part O- ORF; Catalytically dead mutant of the Cas9 from Streptococcus pyogenes.DepositorInsertPart dCas9_O
UseSynthetic BiologyExpressionBacterialMutationNoneAvailable SinceJuly 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDD162 (Peft-3::Cas9 + Empty sgRNA)
Plasmid#47549PurposeCas9 + sgRNA plasmid that can be modified to cleave any Cas9 target site in the C. elegans genome.DepositorInsertsCas9
Empty sgRNA
UseCRISPRTagsHA and NLSExpressionWormMutationCodon optimized and with synthetic introns for C.…PromoterU6 and eef-1A.1 (eft-3)Available SinceSept. 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHiFi Cas9-2×sgRNA (empty, donor)
Plasmid#162277PurposeAll-in-one vector for CRISPR/Cas9-mediated homology-independent knock-in system. The plasmid contains BPNLS-HiFi Cas9-BPNLS and two sgRNA expression cassettes.DepositorInsertHiFi Cas9
UseCRISPRTagsBPNLS and FLAG tagExpressionMammalianMutationSpCas9 (R691A)Available SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTK Cas9-2A-Citrine
Plasmid#92393PurposeEnhancer/reporter plasmid for tissue-specific expression of Cas9 with 2A-Citrine reporter. Contains BsmBI-flanked LacZ cloning cassette for rapid GoldenGate-based cloning of specific enhancers.DepositorInsertCas9 2A Citrine
UseCRISPRExpressionMammalianPromoterthymidine kinase promoterAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CK8e_Cas9_miniPA
Plasmid#226141PurposeAAV construct for HITI insert with CK8e promoter and SpCas9DepositorInsertCas9
UseAAV and CRISPRExpressionMammalianPromoterCK8eAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
1375_pAAV-U6-SA-WTmLdlrEx14-gRNA2-N22-CB-SACas9-HA-OLLAS-spA
Plasmid#109311PurposePlasmid for AAV SaCas9 Mammalian Expression with a gRNA against LdlrDepositorInsertLdlr gRNA
UseAAV and CRISPRExpressionMammalianAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
1476_pAAV-U6-SA-mMttp-gRNA-N21-HLP-SACas9-spA
Plasmid#109315PurposePlasmid for liver-specific expression of AAV SaCas9 with a gRNA against MttpDepositorInsertMttp gRNA
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJUMP18-dCas9_O
Plasmid#127028PurposeBasic Part O- ORF; Catalytically dead mutant of the Cas9 from Streptococcus pyogenes.DepositorInsertPart dCas9_O
UseSynthetic BiologyExpressionBacterialMutationNoneAvailable SinceJuly 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA M3
Plasmid#80936PurposeExpresses Cas9N in mammalian cells; expresses gRNA M3 for Mstn cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA M4
Plasmid#80937PurposeExpresses Cas9N in mammalian cells; expresses gRNA M4 for Mstn cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only