We narrowed to 24,486 results for: CRISPR
-
Plasmid#167983PurposeExpresses TETv4 (TET1CD-XTEN80-dCas9-3xNLS-P2A-BFP) downstream of the CAG promoterDepositorInsertTETv4 (TET1CD-XTEN80-dCas9)
UseCRISPR and Synthetic BiologyTags3xNLS, TET1 catalytic domain, and tagBFPExpressionMammalianPromoterCAGAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ4428 pHR (EF1a-mCherry-P2A-RfxCas13d-2xNLS-ecDHFR-3xFLAG-WPRE)
Plasmid#214885PurposeLentiviral vector encoding TMP-regulatable RfxCas13d-DD fusionDepositorInsertEF1a-mCherry-P2A-RfxCas13d-2xNLS-ecDHFR-3xFLAG-WPRE
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEF1aAvailable SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330 p53
Plasmid#59910PurposepX330 backbone expressing sgRNA targeting p53 to edit mouse p53. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330-SpCas9-NG
Plasmid#117919PurposeExpresses 3xFLAG-NLS-SpCas9-NG-NLS in mammalian cells.DepositorInsertSpCas9-NG (L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R)
ExpressionMammalianAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-hSyn-mCherry
Plasmid#87916PurposesgRNA expressing AAV construct with a mCherry reporter driven by hSyn promoter. (replaced the GFP in pX552 from Zhang lab with mCherry)DepositorInsertmCherry
UseAAV and CRISPRExpressionMammalianPromoterhSynAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJR89
Plasmid#140096PurposesgRNA constant region and hU6 insert for programmed dual sgRNA cloning. The sgRNA constant region contains a capture sequence (cs1) in the stem loop for direct capture Perturb-seq.DepositorInsertsgRNA constant region CR3 with cs1 in stem loop and hU6 promoter
Available SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSJX023
Plasmid#232326PurposeGenome editing in Caulobacter crescentusDepositorInsertssgRNA
SpCas9M
UseCRISPRTagsH-arms and sfGFPExpressionBacterialPromoterPJ23119 and PxylAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
CDK2 gRNA (BRDN0001148950)
Plasmid#77193Purpose3rd generation lentiviral gRNA plasmid targeting human CDK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSJX024
Plasmid#232327PurposeGenome editing in Caulobacter crescentusDepositorInsertssgRNA
SpCas9M
UseCRISPRTagsH-arms and catExpressionBacterialPromoterPJ23119 and PxylAvailable SinceJune 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC013 - Twinstrep-SUMO-huLwCas13a
Plasmid#90097PurposeTwinstrep-SUMO-huLwCas13a for recombinant protein bacterial expression. Insert is human codon optimized but expresses well in bacteria.DepositorInsertLwCas13a
UseCRISPRTags6xHis-Twin Strep-SUMOExpressionBacterialAvailable SinceJune 13, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-T7-ABEmax(7.10)-SpRY-P2A-EGFP (RTW5025)
Plasmid#140003PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with SpRY(D10A/A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1322R/R1333P/R1335Q/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9 variant named SpRY with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpRY=A61R/L1111R/D1135L/S1136W/G121…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB-PEmax
Plasmid#187893PurposeAll-in-one prime editor piggyBac transposon with PEmaxDepositorInsertSpCas9_H840A_KK-MMLV-RT_co-P2A-PAC_dTK
UseCRISPR and Synthetic Biology; Piggybac transposonTagsBPSV40 NLS and c-Myc NLSExpressionMammalianPromoterCAGAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJR85
Plasmid#140095PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs1 incorporated in the loop of the sgRNA constant region. BsmBI sites were removed to allow for programmed dual sgRNA library cloning.DepositorInsertsgRNA with cs1 in stem loop 2 of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-PE3 HEK3
Plasmid#206273PurposeVector for the production of recombinant baculovirus using MultiMate assembly. All-in-one vector for PE3 HEK3 prime editing.DepositorInsertPE2 (synthetic), hU6 HEK3 PegRNA, hU6 HEK3 sgRNA, aeBlue (E. quadricolor), VSV-G, TagBFP
UseCRISPR; Recombinant baculovirus productionExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideFE-Puro
Plasmid#170069PurposeExpresses S. pyogenes CRISPR chimeric RNA element (with F+E modifications) with customizable gRNA from U6 promoter and puromycin resistance from EFS-NS promoterDepositorInsertCas9 guide RNA scaffold with the F+E scaffold modification
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330 Pten
Plasmid#59909PurposepX330 backbone expressing sgRNA targeting Pten to edit mouse Pten. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
CARPID BASU-dCasRx
Plasmid#153209Purposeexpress CARPID BASU-dCasRx fusion protein in mammalian cellsDepositorInsertBASU-dCasRx
UseCRISPR and LentiviralExpressionMammalianMutationR239A/H244A/R858A/H863A in RfxCas13dPromoterEF-1aAvailable SinceJune 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNT/Cre
Plasmid#66895PurposeExpresses a non-targeting gRNA and Cre-recombinaseDepositorInsertsgNT
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianPromoterU6Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only