We narrowed to 7,087 results for: tet
-
Plasmid#24419PurposeHuman 5HT4B receptor with D100A mutation, generating the RASSL Rs1. Expresses mCherry and Rs1 via P2A ribosomal skip sequence. Expresses tTA under EF1α promoter. Rosa26 homology arms for integration.DepositorInsertsUseMouse TargetingTagsFLAG and mCherry-P2AMutationD100APromoterEF1α and TRE, miniCMVAvailable SinceMarch 14, 2011AvailabilityAcademic Institutions and Nonprofits only
-
pINIT_tet
Plasmid#46974PurposeFX sequencing vector for subcloning, tetracycline markerDepositorTypeEmpty backboneUseSequencing vectorPromoternoneAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBItetDMPKSGFP
Plasmid#96903Purposetet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 0 CTG repeats in exon 15 locatedDepositorInsertEGFP and human DMPK exons 11-15 with 0 CTG repeats (DMPK Human)
UseTetracycline responsive and bidirectionalExpressionMammalianPromotertetracycline responsive and bidirectionalAvailable SinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Ets2
Plasmid#70272PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Ets2DepositorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-SynTetOff-myrGFP
Plasmid#190233PurposeAAV vector, high-level expression of EGFP with a myristoylation/palmitoylation signal derived from Fyn N-terminus (myrGFP) in neuronal cellsDepositorInsertEGFP
UseAAVTagsmyristoylation signal sequenceExpressionMammalianAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEnt R3L2 TetO(sh) mCh-Rs1-2
Plasmid#24417PurposeHuman 5HT4B receptor with D100A mutation, generating the RASSL Rs1. Construct expresses both mCherry and Rs1 via a P2A ribosomal skip sequence. Plasmid also known as pEntR3L2 TetO-mCh-Rs1.DepositorInsertRs1
UseGateway CloningTagsFLAG and mCherry-P2AMutationD100APromotershort TetO, miniCMVAvailable SinceMarch 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
P20_992-tetO-deGFP
Plasmid#97096PurposeExpresses GFP in the presence of Pseudomonas fluorescence sigma factor ECF20_992. Repressed by TetRDepositorInsertdeGFP
ExpressionBacterialPromoterP20_992 with TetO operator siteAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
T7-TetO-QF_T7-LacO-TetR_p15A
Plasmid#171659PurposeExpresses QF and/or TetR in BL21(DE3) E. coli according to the presence of aTc. Contains a p15A origin of replication.DepositorInsertT7-LacO-TetR-T7 Stop
ExpressionBacterialPromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMA3288
Plasmid#46885PurposeLentiviral vector encoding Tet-inducible mitochondrially targeted Wild Type human Uracil-N-glycosylaseDepositorInsertUracil-N-glycosylase WT (UNG Human)
UseLentiviralTagsMycExpressionMammalianPromoterTRE-TightAvailable SinceNov. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV TRE3G Neo GFP-Lamin A wildtype
Plasmid#118709PurposeLentiviral TET-ON inducible GFP-Lamin A wildtypeDepositorInsertGFP-Lamin A human wildtype (LMNA Human)
UseLentiviral; Tet-on inducibleTagsGFPExpressionMammalianPromoterCMV TRE3G (TET-ON)Available SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT2-CMV/TetO2-EYFP-GW
Plasmid#153309PurposeTet-On YFP-tagged Gateway destination vector, to be used together with pT2-TetR-neoR transposon plasmidDepositorTypeEmpty backboneUseTransposonTagsYellow Fluorescent ProteinAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hRAF1-shRNA-1
Plasmid#185371PurposeFor tetracycline-inducible mammalian expression of shRNA: CATGAGTATTTAGAGGAAGTA that targets human RAF1DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMA3287
Plasmid#46883PurposeLentiviral vector encoding Tet-inducible mitochondrially targeted Y147A mutant human Uracil-N-glycosylaseDepositorInsertUracil-N-glycosylase, Y147A mutant (UNG Human)
UseLentiviralTagsMycExpressionMammalianMutationY147APromoterTRE-TightAvailable SinceAug. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAB303-Tier1-PhCMV-TetR_VPR
Plasmid#169575PurposeTier-1 vector encoding PhCMV-driven tetracycline-dependent VPR-based transactiavtor (PhCMV-TetR-VPR-pA).DepositorInserttetracycline-controlled transactivator
ExpressionMammalianPromoterPhCMVAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_AB
Plasmid#66008PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [A:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_EB
Plasmid#66009PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [E:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_FB
Plasmid#66010PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [F:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_GB
Plasmid#66011PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [G:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHL1670
Plasmid#37634DepositorInsertsUseSynthetic BiologyTagsASV degradation tag and glgC leader regionExpressionBacterialPromoterpConM12NoHind and pConNoHindAvailable SinceAug. 14, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHL1668
Plasmid#37633DepositorInsertsUseSynthetic BiologyTagsASV degradation tag and glgC leader regionExpressionBacterialPromoterpConM12NoHind and pConNoHindAvailable SinceAug. 10, 2012AvailabilityAcademic Institutions and Nonprofits only