We narrowed to 16,515 results for: grna
-
Plasmid#102972PurposeSuppression of ISCUDepositorInsertshISCU
UseLentiviral and RNAiAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-2-shH1
Plasmid#241994PurposeSleeping Beauty vector for inducible expression of a chicken H1 targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH1
ExpressionMammalianAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-2-shH3
Plasmid#241995PurposeSleeping Beauty vector for inducible expression of a chicken H3 targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH3
ExpressionMammalianAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-2-shH2B
Plasmid#241996PurposeSleeping Beauty vector for inducible expression of a chicken H2B targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH2B
ExpressionMammalianAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-2-shH2A
Plasmid#241997PurposeSleeping Beauty vector for inducible expression of a chicken H2A targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH2A
ExpressionMammalianAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-1-shH2B
Plasmid#240417PurposeSleeping Beauty vector for inducible expression of a chicken H2B targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH2B
ExpressionMammalianPromoterTREAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-2-shH4
Plasmid#240431PurposeSleeping Beauty vector for inducible expression of a chicken H4 targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH4
ExpressionMammalianAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-2-shCtrl
Plasmid#240580PurposeSleeping Beauty vector for inducible expression of a unspecific control shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertScramble shRNA
ExpressionMammalianAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pB-Orthogonal_LTR5Hs_CARGO
Plasmid#248159PurposeEncodes a set of guide RNAs targeting LTR5Hs elements (orthogonal to Addgene #191316)DepositorInsertArray of guide RNAs
UseCRISPRTagsmCherryExpressionMammalianAvailable SinceJan. 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSC-MRscRNA
Plasmid#240211PurposeYeast vector expressing theophylline-responsive MR-scRNADepositorInsertTheophylline MR-scRNA targeting TetO
ExpressionYeastPromoterSNR52Available SinceNov. 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHK001.3QS
Plasmid#235485Purposeinducible NOT gate receiver with bs for sgRNA3DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.6
Plasmid#235471PurposeMessage phagemid carrying sgRNA6 (prom. J23110, backbone pBR322)DepositorInsertsgRNA6
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK052.3
Plasmid#235472PurposeMessage phagemid carrying sgRNA3 (prom. J23119, backbone RSF1030)DepositorInsertsgRNA3
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.23
Plasmid#235484Purposedual NOT gate receiver with bs for sgRNA2 and sgRNA3DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.1
Plasmid#235460PurposeMessage phagemid carrying sgRNA1 (prom. J23119, backbone pBR322)DepositorInsertsgRNA1
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.2
Plasmid#235461PurposeMessage phagemid carrying sgRNA2 (prom. J23119, backbone pBR322)DepositorInsertsgRNA2
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.3
Plasmid#235462PurposeMessage phagemid carrying sgRNA3 (prom. J23119, backbone pBR322)DepositorInsertsgRNA3
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.4
Plasmid#235463PurposeMessage phagemid carrying sgRNA4 (prom. J23119, backbone pBR322)DepositorInsertsgRNA4
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.5
Plasmid#235464PurposeMessage phagemid carrying sgRNA5 (prom. J23119, backbone pBR322)DepositorInsertsgRNA5
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only