We narrowed to 13,284 results for: SHI
-
Plasmid#160476PurposeExpresses SARS-CoV-2 RBD domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationPromoterAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-AVI
Plasmid#160474PurposeExpresses SARS-CoV-2 S2P protein with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationPromoterAvailable sinceOct. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-AVI
Plasmid#160477PurposeExpresses SARS-CoV-2 RBD-SD1 domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationPromoterAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-TET1-S-WT
Plasmid#232942PurposeExpresses short isoform of TET1 in mammalian cells in its wild-type formDepositorInsertTET1-S-WT (TET1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-TET1-S-MUT
Plasmid#232943PurposeExpresses mutant form of the short isoform of TET1 in mammalian cellsDepositorInsertTET1-S-MUT (TET1 Human)
UseLentiviralTagsExpressionMutationH1652Y and D1654APromoterAvailable sinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-no-Flag-TET1-S-WT
Plasmid#232941PurposeExpresses short isoform of TET1 in mammalian cells in its wild-type formDepositorInsertTET1-S-WT (TET1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-mCherry-P2A-Cre-WPRE (AAV1)
Viral Prep#107312-AAV1PurposeReady-to-use AAV1 particles produced from AAV-hSyn-mCherry-P2A-Cre-WPRE (#107312). In addition to the viral particles, you will also receive purified AAV-hSyn-mCherry-P2A-Cre-WPRE plasmid DNA. hSyn-driven expression of mCherry and Cre (physically separate). These AAV preparations are suitable purity for injection into animals.DepositorPromoterTagsmCherry (physically separate, not a fusion protein)Available sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3-SARS2-B.1.617.2
Plasmid#172320Purposeexpressing SARS-CoV-2 B.1.617.2 spike protein (delta strain) for pseudovirus production.DepositorInsertSpike of B.1.617.2 strain (S SARS-CoV-2)
UseTagsExpressionMammalianMutationT19R, 156G, 157-158del, L452R, T478K, D614G, P681…PromoterCMV-FAvailable sinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3-SARS2-B.1.617.1
Plasmid#172319Purposeexpressing SARS-CoV-2 B.1.617.1 (kappa strain) spike protein for pseudovirus productionDepositorInsertSpike of B.1.617.1 strain (S SARS-CoV-2)
UseTagsExpressionMammalianMutationG142D, E154K, L452R, E484Q, D614G, P681R, Q1071H,…PromoterCMVAvailable sinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3_SARS2_Mu
Plasmid#177578Purposeexpressing SARS-CoV-2 B.1.621 (Mu) spike protein for pseudovirus productionDepositorInsertSpike (Mu variant) (S SARS-CoV-2)
UseRetroviralTagsExpressionMammalianMutationT95I, Y144T, Y145S, R346K, E484K, N501Y, D614G, …PromoterCMVAvailable sinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3_SARS2_Lambda
Plasmid#177579Purposeexpressing SARS-CoV-2 C.37 (lambda) spike protein for pseudovirus productionDepositorInsertSpike (Lambda variant) (S SARS-CoV-2)
UseRetroviralTagsExpressionMammalianMutation75-76VI, 246-253N, L452Q, F490S, D614G, T859N, la…PromoterCMVAvailable sinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RA475RG502R-AVI
Plasmid#160480PurposeExpresses SARS-CoV-2 RBD-L455RA475RG502R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RA475RG502R
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine, Alanine 475 to A…PromoterAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RG496R-AVI
Plasmid#160479PurposeExpresses SARS-CoV-2 RBD-L455RG496R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RG496R
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine and changed Glyci…PromoterAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RA475R-AVI
Plasmid#160478PurposeExpresses SARS-CoV-2 RBD-L455RA475R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RA475R
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine and changed Alani…PromoterAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
DH10B-ALT
Bacterial Strain#61151PurposeDH10B modified to constitutively express araC, lacI, and tetR, integrated at the attB site on the E Coli genome. This is DH10B-ALT-Tet with the tetracycline resistance cassette deleted.DepositorBacterial ResistanceNoneAvailable sinceOct. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
Yamamoto Lab TALEN Accessory Pack
Plasmid Kit#1000000030PurposeContains modified pFUS array vectors and destination vectors that are designed for use with the Golden Gate TALEN and TAL Effector Kit.DepositorAvailable sinceMarch 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
Multiplex CRISPR dCas9/FokI-dCas9 Accessory Pack
Plasmid Kit#1000000062PurposeAccessory pack for construction of all-in-one CRISPR/Cas9 vectors expressing multiple gRNAs with either dCas9 or dCas9-FokI fusion; Kit #1000000055 is required to use this kitDepositorAvailable sinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
Multiplex CRISPR/Cas9 Assembly System Kit
Plasmid Kit#1000000055PurposeGolden Gate cloning assembly for construction of all-in-one CRISPR/Cas9 vectors expressing multiple gRNAs with either Cas9 nuclease or Cas9 D10A nickase; see kit #1000000062 for FokI Accessory PackDepositorAvailable sinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
Platinum Gate TALEN Kit
Plasmid Kit#1000000043PurposeEnables construction of highly-active Platinum TALENs using two-step Golden Gate cloning method. Platinum TALENs have variable TALE repeats with either +136/+63 or +153/+47 TALE scaffolds.DepositorAvailable sinceMay 6, 2014AvailabilityAcademic Institutions and Nonprofits only