We narrowed to 33,015 results for: REP
-
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMiR-CIP2A-stop-mut-miR-375-mutA-E
Plasmid#53714PurposeLuciferase reporter assay for CIP2A with mutated firefly stop codon that also has five miR-375 binding site mutationsDepositorInsertCIP2A (CIP2A Human)
UseLuciferaseMutationMutation on the stop codon of firefly luciferase …Available SinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
Dynein-2_complex
Plasmid#132536PurposeFull length human (Hs) IFT dynein (dynein-2) complex for Sf9 expression. Contains His-ZZ-TEV-SNAPf-HC, WDR60, WDR34-Strep, LIC3, TCTEX-1, TCTEX1D2, LC8-1, LC8-2, TCTEX-3, Rbl-1, Rbl-2, LC8-like.DepositorInsertsTags8x His, Linker-TEV-linker-TEV, SNAPf, Strep, and …ExpressionInsectMutationCodon optimised for Sf9 expressionAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
SapTrap-SEC kit for C. elegans genome engineering
Plasmid Kit#1000000109PurposeA collection of C. elegans plasmids used for building homologous repair templates that incorporate a self-excising drug selection cassette (SEC), based on the SapTrap CRISPR/Cas Toolkit.DepositorApplicationGenome EditingVector TypeWorm ExpressionEditing TypeCRISPRAvailable SinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
FUW-OSKM
Plasmid#20328PurposeLentiviral plasmid expressing mouse Oct4, Sox2, Klf4 and cMyc for iPS cell generationDepositorUseLentiviralExpressionMammalianAvailable SinceFeb. 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-OSKM
Plasmid#20321PurposeLentiviral plasmid for tet-inducible expression of mouse Oct4, Sox2, Klf4 and Myc for iPS cell generationDepositorAvailable SinceFeb. 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
NYESO beta/alpha into TRAC HDRT Source (pTR 169)
Plasmid#112021PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR with 1G4 NYESO TCR at TCR-alphaDepositorInsertNYESO beta/alpha into TRAC HDRT
UseCRISPR and Synthetic BiologyAvailable SinceSept. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pαH-rS2d-HexaPro
Plasmid#183515PurposeMammalian cell expression of SARS-CoV-2 Spike protein rS2d-HexaPro with (682-685) furin side replaced with GSAS and mutation S383C, D985C, F817P, A892P, A899P, A942P, K986P,V987PDepositorInsertSpike (S-GSAS-rS2d.HexaPro) (S Severe acute respiratory syndrome coronavirus 2)
Tags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
NYESO alpha/beta into TRBC1 HDRT Source (pTR 262)
Plasmid#112022PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR with 1G4 NYESO TCR at TCR-betaDepositorInsertNYESO alpha/beta into TRBC1 HDRDT
UseCRISPR and Synthetic BiologyAvailable SinceNov. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TREtight-Ngn2:2A:Ascl1-PGK-Puro (XTP-N2A)
Plasmid#84777PurposeSecond generation lenti expressing Mash1 and Neurogenin for iN transdifferentation to neuronsDepositorAvailable SinceNov. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
NYESO alpha into TRAC HDRT Source (pTR 223)
Plasmid#112023PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR-alpha with 1G4 NYESO TCR-alphaDepositorInsertNYESO alpha into TRAC HDRT
UseCRISPR and Synthetic BiologyAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
NYESO beta into TRBC1 HDRT Source (pTR 277)
Plasmid#112024PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR-beta with 1G4 NYESO TCR-betaDepositorInsertNYESO beta into TRBC1 HDRT
UseCRISPR and Synthetic BiologyAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS/XBB.1.5
Plasmid#212991Purpose"Mammalian cell expression of SARS-CoV-2 Spike protein of Omicron.XBB.1.5 variantDepositorInsertpαH-S-GSAS/XBB.1.5 (S )
TagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutation(T19I,Del24/26,A27S,V83A,G142D,Del144,H146Q,Q183E…PromoterCMVAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-B.1.617.2.v1
Plasmid#182575PurposeMammalian cell expression of SARS-CoV-2 Spike protein Delta variant, furin side replaced by GSAS, 2 Proline at 986 and 987 plus T19R-G142D-del156/157-R158G-L452R-T478K-D614G-P681R-D950NDepositorInsertSpike S-GSAS-B.1.617.2.v1 (T19R-G142D-Del156/157-R158G-L452R-T478K-D614G-P681R-D950N) (S Severe acute respiratory syndrome coronavirus 2)
Tags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-RRAR-OMICRON.BA.5
Plasmid#213071PurposeMammalian cell expression of SARS-CoV-2 Spike protein of Omicron.5 with with furin side intactDepositorInsertpαH-S-RRAR-OMICRON.BA.5 (S )
TagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685, furin site inta…Available SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-RRAR/XBB.1.16
Plasmid#213037PurposeMammalian cell expression of SARS-CoV-2 Spike protein of Omicron.XBB.1.16 with with furin side intactDepositorInserts -RRAR.XBB.1.16 (S )
TagsHRV 3C cleavage site (before tags) 8X His tag 2X…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 furin site RRAR …PromoterCMVAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS/XBB.1.16
Plasmid#212992PurposeMammalian cell expression of SARS-CoV-2 Spike protein of Omicron.XBB.1.16DepositorInsertpαH-S-GSAS/XBB.1.16 (S )
TagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutation(T19I,Del24/26,A27S,V83A,G142D,Del144,H146Q, E180…PromoterCMVAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only