This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser.
Learn more
Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected].
Learn more
CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.
All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.
Provides the human codon optimized CDS of Cas9 protein with mutated (D10A, H840A) and inactivated catalytic domains as a level 0 GoldenBraid part for C-terminal fusions