We narrowed to 299 results for: IPTG
-
Plasmid#159405PurposeInducible Perfringolysin O (PFO) expression and purification, controlled under hybrid IPTG-regulated T7/LacO promoter (pRT30)DepositorInsertpr.T7-LacO-6xHis-PFO (Pfo, Clostridium perfringens)
UseSynthetic BiologyTags6xHisExpressionBacterialMutationPromoterT7/LacO promoterAvailable sinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKPY514
Plasmid#62598PurposeEncodes Thr251Gly-EcPheRS Under IPTG-Inducible (PT5) ControlDepositorInsertThr251Gly-EcPheRS
UseTags6xHisExpressionBacterialMutationThr251GlyPromoterT5Available sinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET21a - GR
Plasmid#89614PurposeExpresses recombinant 6HIS tagged T. cruzi Glutathione reductase protein in E. coli upon IPTG inductionDepositorInsertGlutaredoxin
UseTags6HISExpressionBacterialMutationPromoterAvailable sinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_StammerAAA
Plasmid#202587PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the M91A, E92A, and L93A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purificationDepositorInsertORF1p
UseTags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Methionine 91 to Alanine, ORF1p Glu…PromoterAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_StammerAEA
Plasmid#202588PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the M91A and L93A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purificationDepositorInsertORF1p
UseTags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Methionine 91 to Alanine, changed O…PromoterAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPtrcAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPtrcAvailable sinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21a - TryX
Plasmid#89623Purpose[Edit] Expresses recombinant 6HIS tagged T. cruzi tryparedoxin protein in E. coli upon IPTG inductionDepositorInsertTryparedoxin
UseTags6HIS and T7 tag (gene 10 leader)ExpressionBacterialMutationPromoterAvailable sinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21a - TR
Plasmid#89621Purpose[Edit] Expresses recombinant 6HIS tagged T. cruzi trypanothione reductase protein in E. coli upon IPTG inductionDepositorInsertThioredoxin
UseTags6HIS and T7 tag (gene 10 leader)ExpressionBacterialMutationPromoterAvailable sinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCA24N-ligase
Plasmid#87741PurposeIPTG-inducible expression of T4 DNA ligase for protein purificationDepositorInsertT4 DNA ligase (30 )
UseTags6xHisExpressionBacterialMutationPromoterT5-lacAvailable sinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQmod3C-GG
Plasmid#191350PurposeClostridium expression vector (pCB102 origin, cmR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
UseTagsExpressionBacterialMutationPromoterPlacAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXD70LacZ6-LacI-Ptac(LacO)-LacZ
Plasmid#191621PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), IPTG-inducible promoter-lacZ, engineered from pMAL-c2XDepositorInsertlacZ
UseTagsExpressionBacterialMutationPromoterAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFW2500
Plasmid#224213PurposeBacteroides genomic editing tool; IPTG inducible-Fncpf1 and recTDepositorInsertFncpf1 and recT
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJWV102-PL-dCas9
Plasmid#85588PurposeIntegrate plasmid of Streptococcus pneumoniae, for chromosome integration of IPTG-inducible dCas9spDepositorInsertdCas9sp
UseCRISPRTagsExpressionBacterialMutationPromoterPLspAvailable sinceJan. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R130A wgMDH
Plasmid#204266PurposeBacterial expression of R130A wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
UseTags6X HisExpressionBacterialMutationR130APromoterAvailable sinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQmod2C-GG
Plasmid#191347PurposeClostridium expression vector (pBP1 origin, cmR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
UseTagsExpressionBacterialMutationPromoterPlacAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R124K wgMDH
Plasmid#204258PurposeBacterial expression of R124K wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
UseTags6X HisExpressionBacterialMutationR124KPromoterAvailable sinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R124Q wgMDH
Plasmid#204259PurposeBacterial expression of R124Q wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
UseTags6X HisExpressionBacterialMutationR124QPromoterAvailable sinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R124A wgMDH
Plasmid#204257PurposeBacterial expression of R124A wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
UseTags6X HisExpressionBacterialMutationR124APromoterAvailable sinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R130E wgMDH
Plasmid#204267PurposeBacterial expression of R130E wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
UseTags6X HisExpressionBacterialMutationR130EPromoterAvailable sinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMB67EH-Spy
Plasmid#90102PurposeIPTG-inducible CFP/YFP FRET-based biosensor for cyclic-di-GMP measurement using YcgR binding site.DepositorInsertYcgR (ycgR )
UseBroad-host rangeTagsExpressionBacterialMutationPromoterPtacAvailable sinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+)::MBP-NL3F10H
Plasmid#141291PurposeMBP:NLUC:3xFlag:10xHis in pET-28 a (+) backbone for bacterial IPTG inducible expression (KmR)DepositorInsertMBP-NLUC3F10H
UseLuciferaseTagsFlag (x3), His (x10), and MBPExpressionBacterialMutationEngineered for high stability (t1/2 = 11.5 days a…Promoterpromoter for bacteriophage T7 RNA polymeraseAvailable sinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTDpelB-NTwinStrep
Plasmid#45940Purposeuse to create N-terminal PelB-Twin-Strep-tag fusion proteins or dual tagged fusion with N-terminal PelB-Twin-Strep-tag and C-terminal 6x His-tag for periplasmic translocation via PelB signal sequenceDepositorTypeEmpty backboneUseTags6xHis, PelB, and Twin-StrepExpressionBacterialMutationPromoterTrc (lactose/IPTG inducible)Available sinceSept. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pATmin-GG
Plasmid#191352PurposeClostridium expression vector (pAMB1 origin, ermR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
UseTagsExpressionBacterialMutationPromoterPlacAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQmod2E-GG
Plasmid#191345PurposeClostridium expression vector (pBP1 origin, ermR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
UseTagsExpressionBacterialMutationPromoterPlacAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJAB988
Plasmid#133920PurposeminiICE-tet(M)cat(PC194)_PT7-GFP; used to integrate into JAB1000 B. subtilis XPORT strain with IPTG-inducible GFP under T7 promoterDepositorInsertminiICE-tet(M)cat(PC194)_PT7-GFP
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterT7 promoterAvailable sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQmod3E-GG
Plasmid#191348PurposeClostridium expression vector (pCB102 origin, ermR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
UseTagsExpressionBacterialMutationPromoterPlacAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQmod4E-GG
Plasmid#191351PurposeClostridium expression vector (pCD6 origin, ermR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
UseTagsExpressionBacterialMutationPromoterPlacAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R196M wgMDH
Plasmid#204273PurposeBacterial expression of R196M wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
UseTags6X HisExpressionBacterialMutationR196MPromoterAvailable sinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 D193E wgMDH
Plasmid#204269PurposeBacterial expression of D193E wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
UseTags6X HisExpressionBacterialMutationD193EPromoterAvailable sinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQmod2S-GG
Plasmid#191346PurposeClostridium expression vector (pBP1 origin, specR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
UseTagsExpressionBacterialMutationPromoterPlacAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21a - SodA
Plasmid#89612PurposeExpresses recombinant 6HIS tagged T. cruzi superoxide dismutase A protein in E. coli upon IPTG inductionDepositorInsertSuperoxide dismutase A
UseTags6HIS and T7 tag (gene 10 leader)ExpressionBacterialMutationPromoterAvailable sinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21a - APX
Plasmid#89618PurposeExpresses recombinant 6HIS tagged T. cruzi ascorbate-dependent tryparedoxin peroxidase protein in E. coli upon IPTG inductionDepositorInsertAscorbate dependent Tryparedoxin peroxidase
UseTags6HIS and T7 tag (gene 10 leader)ExpressionBacterialMutationPromoterAvailable sinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21a - CPX
Plasmid#89620Purpose[Edit] Expresses recombinant 6HIS tagged T. cruzi cytoplasmic tryparedoxin peroxidase protein in E. coli upon IPTG inductionDepositorInsertCytosolic Tryparedoxin peroxidase
UseTags6HIS and T7 tag (gene 10 leader)ExpressionBacterialMutationPromoterAvailable sinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21a - SodB
Plasmid#89613PurposeExpresses recombinant 6HIS tagged T. cruzi superoxide dismutase B protein in E. coli upon IPTG inductionDepositorInsertSuperoxide dismutase B
UseTags6HIS and T7 tag (gene 10 leader)ExpressionBacterialMutationPromoterAvailable sinceApril 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21a - NDH
Plasmid#89626PurposeExpresses recombinant 6HIS tagged T. cruzi NADP-dependent oxidoreductase in E. coli upon IPTG inductionDepositorInsertNAD(P)-dependent oxidoreductase
UseTags6HIS and T7 tag (gene 10 leader)ExpressionBacterialMutationPromoterAvailable sinceApril 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAPH07
Plasmid#234345PurposeLibrary-scale IPTG-inducible gRNA expression for Type II dCas9 in Synechococcus sp. PCC 7002, genomically integrated next to glpKDepositorInsertType II dCas9 sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterlacUV5Available sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPH021
Plasmid#234346PurposeLibrary-scale IPTG-inducible single transcript dual-gRNA expression for Type II dCas9 in Synechococcus sp. PCC 7002, genomically integrated next to glpKDepositorInsertsType II dCas9 sgRNA
Type II dCas9 sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterlacUV5Available sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQE60 I88A wgMDH
Plasmid#204249PurposeBacterial expression of I88A wgMDH with IPTG induction - Subunit interface mutantInsertMDHG_CITLA
UseTags6X HisExpressionBacterialMutationI88APromoterAvailable sinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R196A wgMDH
Plasmid#204271PurposeBacterial expression of R196A wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
UseTags6X HisExpressionBacterialMutationR196APromoterAvailable sinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only