We narrowed to 23,785 results for: grna
-
Plasmid#172716PurposeDelivery of guide RNA for prime editingDepositorInsertgRNA
ExpressionBacterialAvailable SinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNAEmptyVector_Puro_T2A_BFP2
Plasmid#236729PurposeDual sgRNA empty vector expressing BFP with Puromycin selectionDepositorTypeEmpty backboneUseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_CTRL_Puro_T2A_BFP2
Plasmid#236730PurposeDual sgRNA targeting CTRL expressing BFP with Puromycin selectionDepositorInsertNegative CTRL
UseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
p102_gRNA_Sa_mClover
Plasmid#213778PurposeCloning vector for Sa gRNA, contains Sa gRNA scaffold (with truncations) with mU6 promoter. Includes mClover for bacterial screening and mScarlet for mammalian screening.DepositorInsertSa gRNA
UseCRISPR and LentiviralPromotermU6Available SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
p103_gRNA_Sp_mClover
Plasmid#213779PurposeCloning vector for Sp gRNA, contains Sp gRNA scaffold (with truncations) with mU6 promoter. Includes mClover for bacterial screening and GFP for mammalian screening.DepositorInsertSp gRNA
UseCRISPR and LentiviralPromotermU6Available SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpCas9_sgRNA_expression_in_pBluescript
Plasmid#122089PurposeU6 driven SpCas9 sgRNA expression vector for cloning own guidesDepositorAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
psgRNAc
Plasmid#114006Purposeexpress sgRNA, p15A, CRMDepositorInsertgRNA
PromoterBBa_J23119Available SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHelper_ShCAST_sgRNA
Plasmid#127921PurposeExpresses ShCAST and an empty sgRNA scaffold. New targets can be added using Golden Gate assembly (LguI sites).DepositorInsertShTnsB, ShTnsC, ShTniQ, ShCas12k, sgRNA scaffold for guide cloning (LguI sites)
Available SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRPR1_gRNA_handle_RPR1t
Plasmid#49014PurposegRNA expression empty vector (yeast)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastPromoterpRPR1Available SinceOct. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_mSTING_scrambled_gRNA_1
Plasmid#196627PurposeScrambled control 1 for STING knock-out in murine cells.DepositorInsertmSTING scrambled gRNA 1
UseCRISPR and LentiviralMutationWTAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA.SFFV.tRFP
Plasmid#169941PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and tRFP from SFFV promoter as the marker for infection. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA#1
Plasmid#64245Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_EBFP_to_EGFP_Dual_pegRNA
Plasmid#178100PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and EBFP_To_EGFP pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6GRNA
Plasmid#68370PurposegRNA scaffold with hU6 promoterDepositorTypeEmpty backboneExpressionMammalianPromoterhU6Available SinceFeb. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6b:sgRNA#3
Plasmid#64247Purposeexpresses sgRNA under U6b promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
PtPuc3_diaCas9_sgRNA
Plasmid#109219PurposeEpisome based vector with CRISPR/Cas9_sgRNA module for genome editing in Phaeodactylum tricornutumDepositorInsertsLHCF2 promoter
diaCas9
LHCF1 terminator
U6 promoter
sgRNA
U6 3' region
UseCRISPR and Synthetic BiologyPromoterLHCF1 terminator, LHCF2 promoter, U6 3' regiā¦Available SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
gRNA_AAVS1-T1
Plasmid#41817PurposeExpresses a guide RNA (gRNA) to target human AAVS1 (T1 target sequence) for genome engineeringDepositorInsertgRNA_AAVS1-T1
UseCRISPRExpressionMammalianAvailable SinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pU6c:sgRNA#4
Plasmid#64248Purposeexpresses sgRNA under U6c promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA#2
Plasmid#64246Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only