We narrowed to 15,579 results for: grna
-
Plasmid#106097PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIA1DepositorInsertgRNA TIA1
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_AAVS1_sgRNA_2
Plasmid#155105Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting the AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 promoterAvailable sinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pegRNA2_tevopreQ1
Plasmid#212039PurposeBacterial expression of the pegRNA for genome editing in E. coliDepositorInsertpegRNA
UseCRISPRTagsExpressionMutationPromoterJ23119Available sinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
p102_gRNA_Sa_mClover
Plasmid#213778PurposeCloning vector for Sa gRNA, contains Sa gRNA scaffold (with truncations) with mU6 promoter. Includes mClover for bacterial screening and mScarlet for mammalian screening.DepositorInsertSa gRNA
UseCRISPR and LentiviralTagsExpressionMutationPromotermU6Available sinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
p103_gRNA_Sp_mClover
Plasmid#213779PurposeCloning vector for Sp gRNA, contains Sp gRNA scaffold (with truncations) with mU6 promoter. Includes mClover for bacterial screening and GFP for mammalian screening.DepositorInsertSp gRNA
UseCRISPR and LentiviralTagsExpressionMutationPromotermU6Available sinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA.SFFV.tBFP
Plasmid#169940PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and tBFP from SFFV promoter as the marker for infection. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseLentiviralTagsExpressionMutationPromoterAvailable sinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmCherry_gRNA
Plasmid#80457PurposegRNA expression vector with mCherry transfection controlDepositorInsertssp Cas9 gRNA
mCherry
UseCRISPRTagsExpressionMammalianMutationPromoterU6 and chicken β-actin promoterAvailable sinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
EC2_4_dCas9_VPR_sgRNA
Plasmid#163709PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and VPR activation domainsDepositorInsertsdCas9
VPR
UseTagsExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pgRNA
Plasmid#215560PurposeConstitutively expressed sgRNA targeting a desired gene (this case pta), ColE1 origin, KanRDepositorInsertgRNA
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterJ23119Available sinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA_AAVS1-T1
Plasmid#41817PurposeExpresses a guide RNA (gRNA) to target human AAVS1 (T1 target sequence) for genome engineeringDepositorInsertgRNA_AAVS1-T1
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
PtPuc3_diaCas9_sgRNA
Plasmid#109219PurposeEpisome based vector with CRISPR/Cas9_sgRNA module for genome editing in Phaeodactylum tricornutumDepositorInsertsLHCF2 promoter
diaCas9
LHCF1 terminator
U6 promoter
sgRNA
U6 3' region
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterLHCF1 terminator, LHCF2 promoter, U6 3' regi…Available sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_U6_sgRNA_Mettl3C
Plasmid#165420PurposesgRNA construct for targeting Mettl3 C-terminusDepositorInsertPspCas9 gRNA targeting Mettl3 C-terminus (Mettl3 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgRNA.SFFV.tRFP
Plasmid#169941PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and tRFP from SFFV promoter as the marker for infection. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseLentiviralTagsExpressionMutationPromoterAvailable sinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
gRNA_GFP-T1
Plasmid#41819PurposeExpresses a guide RNA (gRNA) to target GFP (T1 target sequence) for genome engineeringDepositorInsertgRNA_GFP-T1
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
EC2_3_dCas9_Mxi1_sgRNA
Plasmid#163708PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and Mxi1 transcriptional repressorDepositorInsertsdCas9
Mxi1+SV40 NLS
UseTagsExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6GRNA
Plasmid#68370PurposegRNA scaffold with hU6 promoterDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterhU6Available sinceFeb. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
EC2_10_dCas9_VPR_HC_sgRNA
Plasmid#163712PurposeYeast high copy plasmid with dCas9, sgRNA expression cassette and VPR activation domainsDepositorInsertsdCas9
VPR
UseTagsExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_PELO
Plasmid#127124DepositorInsertgRNA PELO (PELO Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIAL1
Plasmid#106096PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIAL1DepositorInsertgRNA TIAL1
UseCRISPRTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only