We narrowed to 3,340 results for: GAI
-
Plasmid#70067PurposeTRC lentiviral vector for shRNA against mouse Dnd1 #6DepositorAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pLKO.1-shDnd1-No8
Plasmid#70069PurposeTRC lentiviral vector for shRNA against mouse Dnd1 #8DepositorAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1.sh.beta-catenin.1248
Plasmid#19761DepositorInsertsmall hairpin RNA against beta-catenin (CTNNB1 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceOct. 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_RB1#2
Plasmid#174151PurposeLentiviral vector expressing Cas9 and a sgRNA against the human RB1 geneDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 mTagBFP2 rat PGK1 shRNA
Plasmid#222869PurposeExpresses mTagBFP2 along with an shRNA against rat PGK1DepositorAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_AMBRA1#2
Plasmid#174153PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1.sh.beta-catenin.2279
Plasmid#19762DepositorInsertsmall hairpin RNA against beta-catenin (CTNNB1 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceJuly 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-CD90.2-Rluc_miR
Plasmid#163360PurposeLentiviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase, with expression of a CD90.2 surface marker.DepositorAvailable SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-YTHDF2-D-MUT (nonsense mutation of sgYTHDF2-1)
Plasmid#232947PurposeExpresses the domain-mutant YTHDF2 with synonymous mutations for resistance against sgYTHDF2-1-mediated knockdownDepositorInsertYTHDF2-D-MUT (YTHDF2 Human)
UseLentiviralMutation5 site mutation (Y418A+D422A+W432A+W486A+W491A), …Available SinceMay 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-YTHDF2-m(6)A-MUT (nonsense mutation of sgYTHDF2-1)
Plasmid#232946PurposeExpresses the m6A-binding-deficient mutant of YTHDF2 with synonymous mutations for resistance against sgYTHDF2-1-mediated knockdownDepositorInsertYTHDF2-m(6)A-MUT (YTHDF2 Human)
UseLentiviralMutation2 site mutation (W432A+W486A), synonymous mutationAvailable SinceMay 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRosa26-1_CBh-Cas9-T2A-BFP-P2A-Ad4E1B
Plasmid#64219PurposeExpression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked via T2A to BFP linked to the Ad4 E1B55K gene via P2ADepositorInsertsCas9
sgRNA targeting ROSA26-1
UseCRISPRTags3xFLAG, NLS, and T2A-BFP-P2A-E1BExpressionMammalianPromoterCBh and U6Available SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_AMBRA1#1
Plasmid#174152PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgX-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209060PurposeEntry cloning vector to insert an sgRNA of interest (using Esp3i digestion) into a vector that already contains sgRNAs against mouse Rb1, Trp53, and Rbl2 and CMV Cre recombinase.DepositorInsertsgRNAs targeting Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionPromoterU6Available SinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgRB1#1
Plasmid#174144PurposeLentiviral vector expressing a sgRNA against the human RB1 geneDepositorAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
CCR5-SZ190b-sfGFP
Plasmid#162447PurposeExpression in HEK293T cell and compete ligand singaling against full-length receptors, the truncated receptor can perform signaling at high ligand concentrationDepositorInsertC-C chemokine receptor type 5 (CCR5 Human)
ExpressionMammalianMutationtruncation from aa88 to aa249PromoterCMVAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-mPGK-CD90.2-Rluc_miR
Plasmid#163332PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the murine PGK promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(BsmBI)-EF1a-BFP-BSD-Dmap1(SDM)
Plasmid#117139PurposeExpression vector encoding BFP-BSD-HA-Dmap1 resistant against gRNA encoded by pKLV2-U6(gDmap1 v4)--PGK-Puro-BFPDepositorInsertHA-Dmap1 (mutagenised) (Dmap1 Synthetic)
UseLentiviralTagsHAExpressionMammalianMutationmodified BFP, modified Dmap1 CDSPromoterhuman U6 promoter, human EF1a promoterAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMY-CD90.2-Rluc_miR
Plasmid#163333PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the LTR promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)-mRuby2
Plasmid#215447PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorTagsmRuby2MutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB.DEST-ITGB1(YYFF)-mRuby2
Plasmid#215449PurposePiggybac expression vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseTransposon-based stable expressionTagsmRuby2ExpressionMammalianMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoterCAGAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO shLuc/FLAG Metap2
Plasmid#209316PurposeLentiviral construct expressing FLAG Metap2 and shRNA against Luciferase (control shRNA)DepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO shLYCHOS/LYCHOS WT-FLAG
Plasmid#209315PurposeLentiviral construct expressing shRNA against LYCHOS and LYCHOS WT-FLAG (resistant to shRNA)DepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO shLYCHOS/FLAG Metap2
Plasmid#209314PurposeLentiviral construct expressing FLAG Metap2 and shRNA against LYCHOSDepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-4gRNA-GBX2-RFP
Plasmid#192288PurposeExpresses RFP and four sgRNAs against GBX2DepositorAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgNotch2#1-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209069PurposeEntry vector that encodes sgRNAs against mouse Notch2, Rb1, Trp53, Rbl2, and CMV Cre recombinase.DepositorInsertsgRNAs targeting Notch2, Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionPromoterU6Available SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgNotch1#1-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209068PurposeEntry vector that encodes sgRNAs against mouse Notch1, Rb1, Trp53, Rbl2, and CMV Cre recombinase.DepositorInsertsgRNAs targeting Notch1, Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionPromoterU6Available SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgErich3#1/Cre
Plasmid#193211PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Erich3 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgErich3#2/Cre
Plasmid#193212PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Erich3 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-RDH11
Plasmid#161924PurposeTo generate RDH11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against RDH11 exon 2.DepositorInsertsgRNA targeting RDH11 exon 2
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgAMBRA1#2
Plasmid#174147PurposeLentiviral vector expressing a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgAMBRA1#1
Plasmid#174146PurposeLentiviral vector expressing a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGMC00001
Plasmid#166718PurposesgRNA against human BAP1DepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGMC00002
Plasmid#166719PurposesgRNA against human BAP1DepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMY-CD90.2-P2A-BlastDYK-Rluc_miR
Plasmid#163341PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a Ly6G surface marker and a DYK-tagged Blasticidin selection markerDepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-CAG-CD90.2-Rluc_miR
Plasmid#163331PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the CAG promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hFTH1-CD90.2-Rluc_miR
Plasmid#163330PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the human FTH1 promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hPGK-CD90.2-Rluc_miR
Plasmid#163329PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the human PGK promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
CXCR4-SZ158a-sfGFP
Plasmid#162446PurposeExpression in HEK293T cell and compete ligand singaling against full-length receptorsDepositorInsertC-X-C chemokine receptor type 4 (CXCR4 Human)
TagssfGFPExpressionMammalianMutationtruncation from aa52 to aa257PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-YTHDF2-RNA-MUT (nonsense mutation of sgYTHDF2-1)
Plasmid#232948PurposeExpresses the RNA-binding-deficient mutant of YTHDF2 with synonymous mutations for resistance against sgYTHDF2-1-mediated knockdownDepositorInsertYTHDF2-RNA-MUT (YTHDF2 Human)
UseLentiviralMutationRNA binding mutation (K416A+R527A), synonymous mu…Available SinceMay 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PCTK1
Plasmid#23754DepositorInsertPCTK1 (CDK16 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag PCTK1
Plasmid#20560DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
BAP1-wt (siRNA resistant)
Plasmid#108439PurposeStable expression of BAP1-wt in mammalian cells, gene has an introduced siRNA-resistance against siBAP1.DepositorInsertBAP1 (BAP1 Human)
ExpressionMammalianMutationc.1641C>T, c.1644T>A, c.1647T>C, c.1650C…PromoterCMVAvailable SinceNov. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
BAP1-C91A (siRNA resistant)
Plasmid#108438PurposeStable expression of BAP1-C91A (catalytically inactive mutant) in mammalian cells, gene has an introduced siRNA-resistance against siBAP1.DepositorInsertBAP1 (BAP1 Human)
ExpressionMammalianMutationC91A: c.271T>G, c.272G>C; others: c.1641C&g…PromoterCMVAvailable SinceNov. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 EGFP-guide1
Plasmid#118166PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA1 against the EGFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 EGFP-guide2
Plasmid#118167PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA2 against the EGFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 BFP-guide1
Plasmid#118165PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA1 against the BFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 EGFP-guide3
Plasmid#118168PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA3 against the EGFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only