We narrowed to 11,250 results for: streptococcus -(crispr) -(cas9)
-
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+)-SpdCas9-LBiT_Strep-Tag-II
Plasmid#198751PurposeExpresses S. Pyogenes dCas9 fused to LargeBiT fragment of split NanoLuc luciferaseDepositorInsertSpdCas9 - LargeBiT
TagsStrep-tag IIExpressionBacterialMutationD10A, H840A (nuclease inactivating mutations in &…PromoterT7Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAT9748-dCBE
Plasmid#163008Purposeplasmid expressing CBE with dCas9DepositorInsertdCBE
UseCRISPRTags3xFLAG and SV40 NLSExpressionMammalianPromoterEF1-aAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX330-PTEN
Plasmid#227440PurposeCas9 expression and a gRNA targeting Exon 6 of mouse PTENDepositorInsertspCas9 and gRNA for mouse PTEN (Pten )
ExpressionMammalianAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+)-SpdCas9-SBiT_Strep-Tag-II
Plasmid#198750PurposeExpresses S. Pyogenes dCas9 fused to SmallBiT fragment of split NanoLuc luciferaseDepositorInsertSpdCas9 - SmallBiT
TagsStrep-tag IIExpressionBacterialMutationD10A, H840A (nuclease inactivating mutations in &…PromoterT7Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMM178
Plasmid#61270PurposeAlso referred to as pRGNndm-1. Expresses Cas9, tracrRNA and a guide RNA which target the NDM-1 gene. Contains a pBBR1 origin and chloramphenicol resistance.DepositorInsertCas9, tracrRNA, crRNA
UseCRISPRTags6xHisExpressionBacterialPromoterpLtetO, native, native (respectively)Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-SP-Cas9 reporter
Plasmid#62733PurposeMammalian CRISPR-SP-Cas9 reporterDepositorInsertCRISPR-SP-Cas9 target seq + tdTomato (out of frame)
UseCRISPR and LentiviralTagsCRISPR-SP-Cas9 target seq (hAAVS1 locus) and HA t…ExpressionMammalianPromoterEF1-AlphaAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSCL391
Plasmid#219501PurposeExpress Ade2 and Faa1 editrons from a single Gal7 promoter, separated by a Csy4 recognition sequenceDepositorInsertEco1 editing ncRNAs and Cas9 gRNAs to edit ADE2 and FAA1
ExpressionYeastPromoterGAL7Available SinceMay 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSP1673
Plasmid#65769PurposeBacterial expression plasmid for S. thermophilus1 Cas9 & sgRNA (need to clone in spacer into BspMI sites): T7-humanSt1Cas9-NLS-T7-BspMIcassette-St1-sgRNADepositorInsertmammalian codon-optimized Streptococcus thermophilus1 Cas9-NLS, and St1Cas9 gRNA
UseCRISPRTagsNLSExpressionBacterialPromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eCas9-GFP-U6-gRNA
Plasmid#79145PurposeAll-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9 expression in human pluripotent stem cellsDepositorInserteSpCas9(1.1)
UseCRISPRTags2A-GFPExpressionMammalianPromoterCAGAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-CASANOVA
Plasmid#113036PurposeAAV vector for CASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
GESTALT_pX330-v1
Plasmid#103061Purposeplasmid px330 with guide targeting GESTALT v1 through V5 constructsDepositorInsertintegration of Cas9 with guide targeting GESTALT barcodes V1 to V5
UseLentiviralAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-SpCas9-HF1
Plasmid#201952PurposeMammalian expression plasmid of high-fidelity SpCas9 variant SpCas9-HF1 with T2A-EGFP and cloning backbone for sgRNADepositorInsertMammalian expression plasmid of high-fidelity SpCas9 variant SpCas9-HF1 with T2A-EGFP and cloning backbone for sgRNA
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianPromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTBL469
Plasmid#126458PurposeExpresses Cas9-15xFlag-TdT in mammalian cells.DepositorAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
Plasmid#61591PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianAvailable SinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pD10AH840AhCas9 (GB1041)
Plasmid#68207PurposeProvides the human codon optimized CDS of Cas9 protein with mutated (D10A, H840A) and inactivated catalytic domains as a level 0 GoldenBraid partDepositorInsertCas9 coding region with mutated (D10A, H840A) and inactivated catalytic domains (human codon optimised)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removed; human codon optimis…Available SinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
PCS2+Cas9-mSA
Plasmid#103882PurposeCas9 mSA for in vitro transcription for gene editing in Mouse EmbryosDepositorInsertCAS9-MSA
UseCRISPRTagsMSA (monomeric streptavidinMutationnonePromoterSP6Available SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas9FnCpf1GG
Plasmid#131013PurposeBackbone plasmid for generating CRISPR arrays for composite array utilized by SpCas9 and FnCas12a using CRATES. Contains a GFP-dropout cassette and two direct repeats.DepositorInsertsdirect repeat of SpCas9
GFP expression cassette
direct repeat of FnCas12a
UseCRISPRExpressionBacterialAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
LC-E03
Bacterial Strain#78552PurposeE. coli strain K-12 MG1655, pTet--Cas9 cassette integrated at 186 primary attB site.DepositorBacterial ResistanceNoneAvailable SinceApril 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
P2061
Plasmid#186299PurposeExpresses LexA-HBD-B112 under the control of pAct1 and Cas9 under the control of LexA-HBD-B112+Beta-estradiol inducible promoterDepositorInsertsLexA-HBD-B112
Cas9
UseCRISPR and Synthetic BiologyExpressionBacterial and YeastPromoter2xLexop-minimalCyc1 and PACT1Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only