We narrowed to 44,340 results for: gats
-
Plasmid#58737Purposeexpression of GFP tagged rabbit Cav2.2 in mammalian cellsDepositorAvailable SinceSept. 2, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pGMβ1
Plasmid#216202PurposeChromosomal gene manipulation (gene insertion, conversion, deletion) of dairy used Lactobacillus bulgaricus, a difficult gene to manipulate, is now possible by conjugation using this pGMB1 plasmid.DepositorTypeEmpty backboneUseShuttle vector, conjugal plasmid, theta type rep…ExpressionBacterialPromoterlac promoter in pGEM-Teasy, Promoters in pAMbeta1…Available SinceJan. 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Kv7.1/pcDNA3.1
Plasmid#111452PurposeElectrophysiology in HEK cellDepositorInsertpotassium voltage-gated channel subfamily KQT member 1 isoform 1 [Homo sapiens] (KCNQ1 Human)
Tags8xHis and EGFPExpressionMammalianAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR-attL5-CRY2-mCh-attL2
Plasmid#160438PurposeEntry vector for cloning Cryptochrome2-mCherry using 2-fragment gateway recombinationDepositorAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mKate2
Plasmid#162624PurposeAllows for transcription of mKate2 control for injection into zebrafish embryos for BiFC assaysDepositorInsertmKate2
ExpressionMammalianPromoterSP6Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEntry_HCoV-OC43-Hemagglutinin-esterase
Plasmid#168943PurposeGateway-compatible Entry vectorDepositorInsertHCoV-OC43-Hemagglutinin-esterase (HE )
UseGateway-compatible entry vectorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-hApg5(K130R)-HA
Plasmid#22949DepositorInsertHomo sapiens ATG5 autophagy related 5 homolog (S. cerevisiae) (ATG5 Human)
Tags3xHAExpressionMammalianMutation130 Lysine to ArginineAvailable SinceJune 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
Cav2.1 HA pCAGGS
Plasmid#206076Purposeexpression of rat Cav2.1 calcium channel with a E1686R mutation to enhance expression and an exofacial double HA tag in domain IIDepositorAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
p5E-CAGGS (JDW 912)
Plasmid#224472PurposeGateway compatible 5' entry clone containing the CAG promoter for constitutive expression of downstream constructs.DepositorInsertCAGGS Promoter
ExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME V5-mTagBFP2 (JDW 830)
Plasmid#224484PurposeGateway compatible middle entry clone containing V5 tagged mTagBFP2 (Cytosolic blue fluorescent reporter)DepositorInsertV5-mTagBFP2
UseGateway cloningAvailable SinceSept. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-V5-mScarlet-I_SV40pA (JDW 968)
Plasmid#224529PurposeA Gateway compatible 3' entry clone containing an V5 mScarlet fusion followed by SV40 late polyADepositorInsertV5-mScarlet-I
UseGateway cloningAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-CDC42-DN
Plasmid#109584PurposeMultisite gateway vector for 3' tagging with dominant negative CDC42DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
[pSK483] pLJC5 Flag-Depdc5(P)
Plasmid#109342PurposeLenti-viral expression of Flag-tagged Depdc5 mutant PDepositorAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS405 PEX14-VAC8-RFP
Plasmid#166844PurposeExpresses Peroxisome localized Vac8-RFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 390 base pairs from the PEX14 ORFDepositorTagsPEX14 transmembrane domain and RFPExpressionYeastMutationPEX14 transmembrane domainPromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS405 SEC66-VAC8-RFP
Plasmid#166843PurposeExpresses ER localized Vac8-RFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 162 base pairs from the SEC66 ORF, which encode the Sec66 transmembrane domain.DepositorTagsRFP and SEC66 transmembrane domainExpressionYeastMutationSEC66 transmembrane domainPromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
[pSK496] pLJC5 HA-Depdc5(AB)
Plasmid#109346PurposeLenti-viral expression of HA-tagged Depdc5 mutant ABDepositorInsertDepdc5 (DEPDC5 Human)
UseLentiviralTagsHAMutationDIYGD(185-189)GSGSG;EQPLH(371-375)GSGSGAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
[pSK497] pLJC5 Flag-Depdc5(AB)
Plasmid#109341PurposeLenti-viral expression of Flag-tagged Depdc5 mutant ABDepositorInsertDepdc5 (DEPDC5 Human)
UseLentiviralTagsFLAGMutationDIYGD(185-189)GSGSG;EQPLH(371-375)GSGSGAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC2
Plasmid#91180PurposeT-DNA vector for combinatorial deletion of NCR genes in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting NCR genes
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
Kv7.4 (1-645, Δ368-523)/pcDNA3.1
Plasmid#111456PurposeElectrophysiology in HEK cellDepositorInsertpotassium voltage-gated channel subfamily KQT member 4 isoform a [Homo sapiens] (KCNQ4 Human)
ExpressionMammalianMutationKv7.4 (1-645, Δ368-523), C643AAvailable SinceMay 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSC3
Plasmid#91181PurposeT-DNA vector for targeted deletion of 58kb region in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
p3E-mCherry-SV40-pA (JDW 1417)
Plasmid#242570PurposeGateway 3' entry clone containing mCherry followed by an SV40 polyA.DepositorInsertmCherry stop SV40 pA
UseGateway subcloningAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXMLC2-DEST (JDW 7)
Plasmid#229833PurposeA gateway compatible destination vector containing the Xenopous myosin light chain 2 promoter for embryonic and adult cardiomyocyte expression.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-StayGoldc4-Giantin (JDW 1355)
Plasmid#229844PurposeA gateway compatible middle entry clone containing a V5 tagged n2StayGoldc4 flourescent proteinDepositorInsertn2StayGoldc4
UseGateway entry cloneAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
p5E_hs_Glast (JDW 1182)
Plasmid#224483PurposeGateway compatible 5' entry clone containing the Human GLAST promoterDepositorInsertGLAST promoter
ExpressionMammalianAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-LexA-mODC (no LexOp) (JDW 937)
Plasmid#224504PurposeGateway compatible middle entry clone containing a destabilized LexA transactivatorDepositorInsertLexA-mODC
UseGateway cloningAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME H2B mCerulean (JDW 1150)
Plasmid#224543PurposeA Gateway compatible middle entry clone containing a histone H2B fusion to mCerulean to label the nucleusDepositorInsertH2B-mCerulean
UseGateway cloningAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-His10-ccdB-SNAP
Plasmid#166146PurposeGateway destination vector for generation of N-terminal His10-tagged and C-terminal SNAP-tagged proteins in E. coli.DepositorTypeEmpty backboneTagsHis10 and SNAPExpressionBacterialAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-His10-Smt3-ccdB
Plasmid#166147PurposeGateway destination vector for generation of N-terminal His10-Smt3 tagged proteins in E. coli.DepositorTypeEmpty backboneTagsHis10-Smt3ExpressionBacterialAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-His10-Smt3-ccdB-SNAP
Plasmid#166148PurposeGateway destination vector for generation of N-terminal His10-Smt3 and C-terminal SNAP tagged proteins in E. coli.DepositorTypeEmpty backboneTagsHis10-Smt3 and SNAPExpressionBacterialAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cav2.2 DomI + DomII pcDNA3
Plasmid#206094Purposeexpression of the N-terminus, Domain I, Domain II and the II-III loop (amino acids 1-1154) of rabbit Cav2.2 calcium channelDepositorAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cav2.2 DomI pMT2
Plasmid#206127Purposeexpression of the N-terminus, Domain I and the I-II loop (amino acids 1-483) of rabbit Cav2.2 calcium channelDepositorAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEntry_HCoV-NL63-Protein3
Plasmid#168923PurposeGateway-compatible Entry vectorDepositorInsertHCoV-NL63-Protein3 (HCNV63gp3 )
UseGateway-compatible entry vectorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEntry_SARS-CoV-2-Spike
Plasmid#168891PurposeGateway-compatible Entry vectorDepositorInsertSARS-CoV-2-Spike (S )
UseGateway-compatible entry vectorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNB_EA_R1CiM_4EGFP_R3EGFPi2
Plasmid#185968PurposeMolecular IMPLY gate, encodes mutant Ci protein from Plteto-1 promoter, and EGFP form PR and PlTataa promoter. Must be expressed in E.coli DH5alphaz1 for experimental characterization.DepositorInsertMolecular IMPLY gate
UseSynthetic BiologyAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R4-bpFOG-B5::B1-NLSLacZ-B2
Plasmid#186414PurposeAttR3/R4 destination vector for ascidian electroporation with AttB1/B2 recombined NLSLacZ under control of AttB4/B5-recombined pFOG ectodermal regulatory sequence.DepositorInsertlacZ (lacZ E. coli)
UseGateway destination vectorTagsNuclear localization signalPromoterBasal promoter of the FOG geneAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCu-His6-Atg13[571–700]-Ss(424)
Plasmid#166852PurposeExpresses 6xHis tagged ATG13 [571–700] fragment with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeast.DepositorAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS405 SEC66-VAC8-GFP
Plasmid#166840PurposeExpresses ER localized Vac8-GFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 162 base pairs from the SEC66 ORF, which encode the Sec66 transmembrane domain.DepositorTagsGFP and SEC66 transmembrane domainExpressionYeastMutationSEC66 transmembrane domainPromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
p3E-ARF1-DN
Plasmid#109590PurposeMultisite gateway vector for 3' tagging with dominant negative ARF1DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3E-ARF6-DN
Plasmid#109592PurposeMultisite gateway vector for 3' tagging with dominant negative ARF6DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONRG_P4-P1R:TBA2p
Plasmid#128429PurposeGateway (Invitrogen) promoter clone (pDONRG_P4-P1R) containing the TBA2 (At1g62060) promoter sequence (1346 base pairs), for use in Three-way Gateway cloning.DepositorInsertTESTA ABUNDANT 2 (AT1G62060 Mustard Weed)
UseGateway promoter entry clonePromoterTESTA ABUNDANT 2Available SinceOct. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pK_P-GAP-LM_lacO-cP-AOX1-sAR
Plasmid#126745Purposeyeast plasmid overexpressing sLovA,CPR and LacI-Mit1ADDepositorInsertslovA,cpr
Tags6xHisExpressionYeastPromoterGAPAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pK_P-ICL1-LM_lacO-cP-AOX1-sAR
Plasmid#126744Purposeyeast plasmid overexpressing sLovA,CPR and LacI-Mit1ADDepositorInsertslovA,cpr
Tags6xHisExpressionYeastPromoterICL1Available SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
[pSK480] pLJC5 Flag-Depdc5(A)
Plasmid#109338PurposeLenti-viral expression of Flag-tagged Depdc5 mutant ADepositorAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
[pSK481] pLJC5 Flag-Depdc5(B)
Plasmid#109339PurposeLenti-viral expression of Flag-tagged Depdc5 mutant BDepositorAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
[pSK479] pLJC5 Flag-Depdc5(C)
Plasmid#109340PurposeLenti-viral expression of Flag-tagged Depdc5 mutant CDepositorAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMT2 Cav2.2 DomI and DomII
Plasmid#89891PurposeMammalian expression of Cav2.2 DomI and DomII, this contains the first 2 domains (amino acids 1 -1154) of Cav2.2DepositorInsertCacna1b (CACNA1B )
ExpressionMammalianMutationStop codon after amino acid 1154 (this is a trunc…Promoteradenovirus major late promoterAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
Kv7.4 (1-645, Δ368-492)/pcDNA3.1
Plasmid#111454PurposeElectrophysiology in HEK cellDepositorInsertpotassium voltage-gated channel subfamily KQT member 4 isoform a [Homo sapiens] (KCNQ4 Human)
ExpressionMammalianMutationKv7.4 (1-645, Δ368-492), C643AAvailabilityAcademic Institutions and Nonprofits only