-
Plasmid#220992PurposehACTB atgRNADepositorInsertACTB atgRNA (ACTB Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xPax7gRNA
Plasmid#224570PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)ExpressionMutationCodon optimizedPromoterAvailable sinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xPax7gRNA
Plasmid#224571PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalExpressionMutationCodon optimizedPromoterAvailable sinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-hL1-gRNA1-EGFP
Plasmid#226002PurposeCRISPRi-KD of human LINE1DepositorInsertsgRNA targeting human L1HS
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-hL1-gRNA2-EGFP
Plasmid#226003PurposeCRISPRi-KD of human LINE1DepositorInsertsgRNA targeting human L1HS
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
eGFP-SUN1ΔN
Plasmid#213508PurposeExpresses human eGFP-SUNΔN in mammalian cellsDepositorInserteGFP-SUNΔN
UseTagsExpressionMammalianMutationSUN1ΔN has the first 138 amino acid (lamina domai…PromoterCMVAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA238
Plasmid#215942PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD47_v4 [Sp]; trRNA_v4 [Sp]
UseCRISPR; FragmentTagsExpressionMutationPromoterAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shPP1C #2
Plasmid#198763Purposeconditional knockdown of PP1CDepositorInsertshPP1C #2 (PPP1CC Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCL.178
Plasmid#184999PurposeExpress -Eco1 FANCF editing ncRNA and gRNADepositorInsertEco1: FANCF targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
UseTagsSV40NLSExpressionMammalianMutationFANCF donor, a1/a2 length extended for 27 bpPromoterH1Available sinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx3_gRNA2_dTet_mTurquoise2
Plasmid#189805PurposeRetroviral delivery of guide RNA against mouse Runx3DepositorInsertgRunx3_gRNA2 (Runx3 Mouse)
UseRetroviralTagsExpressionMutationPromoterAvailable sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgCebpa_v2-hu6-sgCebpd_v2
Plasmid#177254PurposeExpresses Cebpa_v2 (mU6), Cebpd_v2(hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v2/sgCebpd_v2
UseLentiviralTagsExpressionMutationPromotermU6/hU6Available sinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178099PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_F2108L_Dual_pegRNA
Plasmid#178102PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-F2108L pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR-F2108L pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_I2017T_Dual_pegRNA
Plasmid#178103PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-I2017T pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR-I2017T pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_MTOR_I2017T_Dual_pegRNA
Plasmid#178108PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 T804N-G6 and MTOR-I2017T pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G6 T804N pegRNA + MTOR-I2017T pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_MTOR_F2108L_Dual_pegRNA
Plasmid#178109PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 T804N-G6 and MTOR-F2108L pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G6 T804N pegRNA + MTOR-F2108L pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_RUNX1_+4_T_to_G_Dual_pegRNA
Plasmid#173212PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and RUNX1 +4 T to G pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + RUNX1 +4 T to G pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHJ4
Plasmid#158785PurposePan-neuronal nuclear-localized GCaMP expression in C. elegansDepositorInsertPrab-3::nls::GCaMP6m
UseTagsNLSExpressionWormMutationPromoterAvailable sinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorInsertUPF3B (UPF3B Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only