We narrowed to 9,463 results for: CAG
-
Plasmid#32478PurposeExpresses PSAM-GlyR (L141F) neuronal inhibitor, with IRES-EGFP markerDepositorInsertPSAML141F-GlyR
TagsIRES-GFPExpressionMammalianPromoterCAGAvailable SinceApril 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pXL-CAG-3XAP-NLG1
Plasmid#43923DepositorInsert3XAP-NLG1
TagsHAExpressionMammalianPromoterChicken Beta ActinAvailable SinceApril 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHIE041 CAG mKate2 (TUPV 1)
Plasmid#138721PurposemMoClo TUPV, with CAG promoter and mKate2 in the MCSDepositorInsertCAG
UseSynthetic BiologyExpressionMammalianPromoterCAGAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRAPPC10_pLENTI-CAG-IRES-GFP
Plasmid#176998PurposeMammalian lentiviral expression vector encoding TRAPPC10DepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
DsRed2_pLENTI-CAG-IRES-GFP
Plasmid#177010PurposeMammalian lentiviral expression vector encoding DsRed2DepositorInsertDsRed2
UseLentiviralPromoterCAGAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Flag-hsDicer (D1320A)
Plasmid#41586DepositorAvailable SinceFeb. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-mScarlet-I-Cdt1
Plasmid#191100PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsertmScarlet-I-Cdt1 (30-120)
UseAAV and Synthetic BiologyTagsmScarlet-I fused to residues 30-120 of human Cdt1…ExpressionMammalianMutationOptimized to human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXL-CAG-ICeuI-sHRPaNRX3beta
Plasmid#79910PurposepiggyBac transposon vector, sHRPaNRX3betaDepositorInsertsHRPaNRX3beta
UsePiggybacExpressionMammalianAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-K-red-SPOTIT
Plasmid#191490PurposeRed fluorescent-based opioid sensor for the kappa opioid receptor in AAV viral vector under a CAG promoterDepositorInsertK-red-SPOTIT
UseAAVPromoterCAGAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-M-red-SPOTIT2
Plasmid#191491PurposeRed fluorescent-based opioid sensor for the mu opioid receptor in AAV viral vector under a CAG promoterDepositorInsertM-red-SPOTIT2
UseAAVPromoterCAGAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-attBr-Cre-rc-attP
Plasmid#51264PurposeComponent of the Bxb1-rcCre binary site-specific recombinase system, reverse complementary Cre CDS flanked by Bxb1 attB/P recognition sites in head-to-head orientationDepositorInsertattBr-Cre-rc-attP
ExpressionMammalianPromoterCAGAvailable SinceMarch 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex-GFP
Plasmid#197883PurposeCan be used to generate AAV virus that will express GFP in the presence of CreDepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CAG::PSAMQ79G:GlyR-IRES-GFP
Plasmid#32482PurposeExpresses PSAM-GlyR (Q79G) neuronal inhibitor, with IRES-EGFP markerDepositorInsertPSAMQ79G-GlyR
TagsIRES-EGFPExpressionMammalianPromoterCAGAvailable SinceApril 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FLAG-BMAL1-S513A
Plasmid#186831PurposeExpresses FLAG-BMAL1-S513A in mammalian cellsDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FLAG-BMAL1-S515A
Plasmid#186832PurposeExpresses FLAG-BMAL1-S515A in mammalian cellsDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FLAG-BMAL1-S516A
Plasmid#186833PurposeExpresses FLAG-BMAL1-S516A in mammalian cellsDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FLAG-BMAL1-S519A
Plasmid#186834PurposeExpresses FLAG-BMAL1-S519A in mammalian cellsDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Flag-S1pr1-R120A
Plasmid#203707PurposeOverexpression of FLAG-S1PR1-R120A mutant.DepositorAvailable SinceDec. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only