We narrowed to 4,533 results for: Gaa
-
Plasmid#131496PurposeEndogenous tagging of Shank2: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pLKO-shSmad2
Plasmid#37051DepositorAvailable SinceJan. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1_ASCL1
Plasmid#64129PurposePhotoactivatable transcription system. Lentiviral expression of ASCL1 sgRNA1. Also contains a CMV-puro-t2A-mCherry expression cassette.DepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_LacZ_sgRNA
Plasmid#74179Purposelentiviral vector expressing sgRNA targeting LacZDepositorInsertLacZ sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2.sgNf1.4
Plasmid#92029PurposesgNf1.4 for Nf1 deletionDepositorInsertsgNf1.4 for Nf1 deletion
UseLentiviral and Mouse TargetingExpressionMammalianAvailable SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-RAB7A
Plasmid#227297PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of RAB7A for knock-in.DepositorInsertsgRNA Targeting N-terminus of RAB7A (RAB7A Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCas9-sgVRK1 #1-Blast
Plasmid#199646PurposeExpresses Cas9 and sgRNA guide targeting VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mMyh9 - 1
Plasmid#198491Purposelentiviral stable expression of mMyh9 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Nanog_2
Plasmid#174871PurposeCRISPR vector for generating Nanog STREAMING-tag KI cellDepositorInsertsgRNA for mouse Nanog (Nanog Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_ELAVL1
Plasmid#106106PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting ELAVL1DepositorInsertgRNA targeting ELAVL1 (ELAVL1 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
NEK7 gRNA (BRDN0001162196)
Plasmid#77740Purpose3rd generation lentiviral gRNA plasmid targeting human NEK7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCcnb2
Plasmid#162794PurposeCcnb2 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-Smad4
Plasmid#89829PurposeKnockdown human Smad4 expression in human mammalian cellsDepositorInsertSmad4 shRNA (SMAD4 Mouse, Human)
UseRetroviralAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-TKT_sgRNA1
Plasmid#201624PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertTKT (TKT Human)
UseCRISPR and LentiviralAvailable SinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN063
Plasmid#91596PurposeExpress sgRNA targeting human DFNA5DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNT.3#3/Cre
Plasmid#173662PurposeExpresses a NT.3-targeting gRNA and Cre-recombinaseDepositorInsertNon-targeting gRNA
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSCV-miR30_shBrd9_1061-PGK-NeoR-IRES-mCherry
Plasmid#75132PurposeRetroviral expression plasmid encoding shBrd9_1061 (targeting murine Brd9)DepositorInsertshBrd9_1061
UseRetroviralAvailable SinceMay 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
PHKG1 gRNA (BRDN0001144981)
Plasmid#76356Purpose3rd generation lentiviral gRNA plasmid targeting human PHKG1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-DDX58-ts1
Plasmid#174241PurposeDDX58 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRELA
Plasmid#83944PurposeLentiviral vector expressing an sgRNA targeting RELA NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgRELA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-Puro HLAG-2A-sgRNA
Plasmid#182551PurposeCas9 from S.pyogenes with 2A-Puro, and the 2A-sgRNA to targeting exon 2 of human HLA-G geneDepositorInserthSpCas9-2A-Puro-HLAG-2A-sgRNA
UseCRISPRExpressionMammalianPromoterCbhAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PKN3 gRNA (BRDN0001146792)
Plasmid#77948Purpose3rd generation lentiviral gRNA plasmid targeting human PKN3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-shKcnk13
Plasmid#120721PurposeExpresses GFP and an shRNA targeting Kcnk13 (in pLL3.7)DepositorInsertKcnk13 (Kcnk13 Mouse)
UseLentiviral and RNAiTagsGFPExpressionMammalianPromotermouse U6Available SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiCas9-sgCh2-2-Blast
Plasmid#199645PurposeExpresses Cas9 and sgRNA control guide targeting intergenic regionDepositorInsertN/A
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMETAP1_2
Plasmid#163463Purposelentiviral vector expressing Cas9 and an sgRNA targeting METAP1DepositorInsertsgRNA 2 targeting METAP1 (METAP1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-miR30_shBrd9_1061-PGK-NeoR-IRES-GFP
Plasmid#75129PurposeRetroviral expression plasmid encoding shBrd9_1061 (targeting murine Brd9)DepositorInsertshBrd9_1061
UseRetroviralAvailable SinceMay 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSL0746 (pDonor_R-MmeI)
Plasmid#130646PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 CAST, with CmR cargo gene. The mutated right end introduces an MmeI recognition site (used for Tn-seq). Total transposon size = 977 bp.DepositorInsertVchCAST donor DNA (R*)
UseCRISPR; TransposonExpressionBacterialMutationTGTTGATA --> TGTTGGAAAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-MS2
Plasmid#184839PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the MS2 phage genome and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the MS2 phage genome, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and lac promoterAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
OR6K6_Deletion_gRNA3
Plasmid#195197Purposedual gRNAs for deletion of OR6K6 in a third generation Cas9 backbone with GFPDepositorInsertOR6K6 dual gRNA (OR6K6 Human)
ExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only