We narrowed to 3,540 results for: cgas
-
Plasmid#90684Purpose3rd generation lentiviral gRNA plasmid targeting human EZH2DepositorInsertEZH2 (Guide Designation E9.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx1_gRNA3_dTet_NGFR
Plasmid#189803PurposeRetroviral delivery of guide RNA against mouse Runx1DepositorInsertgRunx1_gRNA3 (Runx1 Mouse)
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP gRNA (BRDN0000562805)
Plasmid#80035Purpose3rd generation lentiviral gRNA plasmid targeting EGFPDepositorInsertEGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Bsn KI
Plasmid#139664PurposeEndogenous tagging of Bassoon: N-terminal (amino acid position: L7)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Kan-ADE2
Plasmid#232105PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDF0584 huDisCas7-11 S1006-GGGS-D1221 U6-NT guide
Plasmid#186993PurposeAAV transgene plasmid for Cas7-11-S1006-GGGS-D1221, with U6 promoter-driven expression of non-targeting crRNA guideDepositorInsertcas7-11-s1006-gggs-d122, non-targeting crRNA guide
UseAAVMutations1006-gggs-d1221 deletionAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW267-lenti-spsgRNA-hsCDH1-sg1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#170816PurposeLentiviral vector to co-express a human CDH1 spsgRNA (sg1-Cdh1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR
UseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
HUWE1-sgRNA-1
Plasmid#86924PurposeTo express sgRNA target HUWE1 geneDepositorAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
HUWE1-sgRNA-2
Plasmid#86925PurposeTo express sgRNA target HUWE1 geneDepositorAvailable SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
CBX3 A5.5 gRNA
Plasmid#90568Purpose3rd generation lentiviral gRNA plasmid targeting human CBX3DepositorInsertCBX3 (Guide Designation A5.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330.sgNf1.4
Plasmid#92028PurposepX330 sgNf1.4 for Nf1 deletionDepositorInsertsgNf1.4
UseMouse TargetingExpressionMammalianAvailable SinceNov. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
LLP773_pLenti-6xHRBKET-sgRNA
Plasmid#211766PurposeMultiplexed gRNA plasmid targeting six different gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1), with mCherry selectionDepositorInsertgRNAs against six different human gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1)
UseLentiviralPromoterpCMV and U6Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
RRM1 E2.3 gRNA
Plasmid#90881Purpose3rd generation lentiviral gRNA plasmid targeting human RRM1DepositorInsertRRM1 (Guide Designation E2.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Blast-sgNT
Plasmid#138678PurposeExpresses a Non-targeting sgRNA and Cas9DepositorInsertsgNT
UseLentiviralPromoterhU6Available SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-RacFRET-U6ac-ctrl guides
Plasmid#168247Purpose"label active Rac; control for neutrophil-specific knockout"DepositorInsertRacFRET
UseZebrafish expressionPromoterLyzCAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pQdCas9.luxR(mut)-sggfp
Plasmid#236185PurposeThe plasmid pQdCas9.luxR(mut)-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the GFP gene. Additionally, this plasmid contains a mutation in the luxR gene.DepositorInsertQuorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(C)
Plasmid#236043PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(C) expresses the dCas12a endonuclease and the sgRNA (design C) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (C) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.shHmga2
Plasmid#32399DepositorAvailable SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only