We narrowed to 11,385 results for: mpl
-
Plasmid#36997DepositorAvailable SinceMay 21, 2012AvailabilityAcademic Institutions and Nonprofits only
-
pSUPER.retro.puro-HCF-1-B
Plasmid#36996DepositorAvailable SinceMay 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1A-Dm-mir-12
Plasmid#22760DepositorInsertmicro RNA 12 (mir-12 primary transcript, Fly)
UseDrosophila expressionAvailable SinceDec. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3 HRPT2 L64P
Plasmid#11052DepositorAvailable SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pMMS22L-siR3
Plasmid#221013Purposemammalian expression vector of myc-Flag tagged MMS22L siRNA resistantDepositorInsertMMS22L (MMS22L Human)
TagsFlag and mycExpressionMammalianMutationsilent mutations MMS22L: 5'-aaAacGtgTtgCtgTg…PromoterCMVAvailable SinceJuly 31, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pD649-HAsp-NECTIN4-COMP5AP-AviTag-9xHis
Plasmid#157319PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBITE-EGFRvIII-F271-OKT3
Plasmid#190682PurposeEncodes an EGFRvIII-CD3 BITE protein (F271 clone)DepositorInsertAnti-EGFRvIII-scFv-F271-modularized-OKT3-HisTag
UseLentiviralTagsmNeonGreenExpressionMammalianPromoterEFSAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBFC0687
Plasmid#186692PurposeShDART under control of Lac promoter, original configuration (pre-gRNA terminator and J23119 promoter), Sh_2xBsaI_NT gRNA, GmR+sfGFP cargoDepositorInsertstnsB
tnsC
tniQ
Cas12k
Sh_2xBsaI_NT (Guide Stuffer) gRNA
Tn7 transposon
GmR+sfGFP ShDART Cargo
ExpressionBacterialPromoterPLacAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
6xHis-MBP-huBsCas12a
Plasmid#174671PurposeExpresses 6xHis-MBP tagged BsCas12aDepositorArticleInserthuBsCas12a
UseCRISPR and Synthetic BiologyTags6xHis, MBP, TEV, NLS and NLS, 3xHA, T2A, EGFP, 6x…ExpressionBacterialPromoterT7Available SinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-mNaChBacMUT-P2A-EGFP
Plasmid#176281PurposeViral vector for co-expression of non-functional NaChBac and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertmNaChBacMUT-P2A-EGFP
UseAAV and Cre/LoxExpressionMammalianMutationE191KPromoterhuman Synapsin IAvailable SinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-AviMta2-3xFiBsd
Plasmid#140964Purposefull-length wt Avi-Mta2-3XFLAG-iBsd cDNA w/CAG promoter and Blasticidin resistance, cloned from mouse ES cellsDepositorInsertmetastasis-associated gene family, member 2 (Mta2 Mouse)
Tags3xFLAG, Avi, and TEVExpressionMammalianPromoterCAGAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRepair-SGFP2-CTNNB1
Plasmid#153430PurposeHomology Directed Repair construct for N-terminal tagging of hsCTNNB1 with SGFP2DepositorInsertCTNNB1 homology arms and mTurquoise2 coding sequence (CTNNB1 Human)
UseCRISPR; Hdr donor templateTagsSGFP2Available SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-FH-Nsp13_GC3opt
Plasmid#157715Purposemammalian expression of N-terminally Flag-His8 tagged SARS-CoV-2 Nsp13 under control of a tetracycline-inducible promoterDepositorInsertFH-Nsp13_GC3opt (ORF1ab SARS-CoV-2)
TagsFlag-His8ExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEBTet-SNAP-CCCAP
Plasmid#136798PurposeMammalian expression of the centrosomal protein CCCAP N-terminally fused to SNAP-tagDepositorInsertSNAP-CCCAP (SDCCAG8 Synthetic, Human)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMyc1ElbLuc,
Plasmid#53243Purposereporter plasmid containing 1 myc cDNA binding sitesDepositorInsertpMyc1ElbLuc (MYC Human)
MutationTo prepare plasmids with one, two, three, and fou…Available SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA1 Flag ATXN1[85Q]-S776A
Plasmid#33240DepositorInsertAtaxin-1 (ATXN1 Human)
TagsflagExpressionMammalianMutationinsert contains a stretch of 85 Glutamines and no…PromoterCMVAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-ATXN1 FL(2Q)
Plasmid#21752DepositorInsertAtaxin-1 (ATXN1 Human)
TagsGSTExpressionMammalianMutationinsert contains 2Q (2 glutamines) and there isno …PromoterCMVAvailable SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSADB19-dTomato Barcode Library
Pooled Library#227671PurposeRVdG genome plasmids that carry an error-correctable barcode compatible with 3’ capture single cell or single nuclei RNA sequencing readout. For the production of SADB19 strain G-deleted rabies virus.DepositorExpressionMammalianSpeciesSyntheticAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNLS-2xBFP(4C)
Plasmid#176151PurposeEncodes NLS-2xBFP(4C), which is a tandem BFP with an N-terminal SV40 NLS. The protein has 4 solvent accessible cysteines for labeling with maleimide dyes.DepositorInsertNLS-2xBFP(4C)
Tags6xHis tag and SV40 nuclear localization sequence …ExpressionBacterialMutationCompared with EGFP, the two BFP domains have the …PromoterPtrcAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2442 - [1-2] ENTR - Fluor - ce-tagRFP-T(PATCs(900bp), NLS, no_atg, no stop)
Plasmid#159858PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-tagRFP-T(PATCs(900bp), NLS, no_atg, no stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
Brg1 Del3 pET28a
Plasmid#122117PurposeExpression Brg1 amino acids 836-1446 in bacteriaDepositorAvailable SinceMarch 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSICO-CPSF6-358-iRFP670
Plasmid#110694PurposeExpresses a truncated form of CPSF6 (CPSF6-358 originally described in Lee et al. Cell Host Microbe 2010) fused with iRFP670DepositorInsertCPSF6-iRFP670 (CPSF6 Human)
UseLentiviralTagsiRFP670MutationTruncation of CPSF6 isoform at amino acid 358Available SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-EF1.Pro
Plasmid#79488PurposeMultiSite Gateway entry clones, first fragment, (attL1, attR5) Human EF1 promoterDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
Pmyo3::tag:sl1(G16C)
Plasmid#79003PurposeExpression of exogenous SL1 in C. elegans muscleInsertsls-1.2 (sls-1.2 Nematode)
Tagsillumina-adapterExpressionWormMutationG16CPromotermyo-3Available SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-SIGLEC11-Fc(DAPA)-AviTag-6xHis
Plasmid#156907PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertSIGLEC11 (SIGLEC11 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD deltahexa
Plasmid#169714PurposeBacterial Expression of human hnRNPA1-A Low complexity domain including amino acids 186-320, hexapeptide including aa 259-264 deletedDepositorInserthnRNPA1 (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationhnRNPA1-A Low complexity domain including amino a…PromoterT7Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
UPRT-mCh-Nluc-P2A-neo-UPRT
Plasmid#135015PurposeExpresses mCherry protein and a fusion protein of Nluc-neo inserting into Cryptosporidium parvum UPRT locusDepositorInsertsmCh-Nluc-P2A-neo
UPRT 5'UTR
UPRT 3'UTR
UseCryptosporidium expressionTagsmCherry and Nluc-neoPromoterCryptosporidium actin and enolaseAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-miR-124-sponge_rev(neg. CTRL)
Plasmid#117326PurposeDual luciferase assay negative control for miR-124 bindingDepositorInsertreverse miR-124 sponge
UseLuciferaseTagsluciferaseExpressionMammalianPromoterMurine PGK-1Available SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only