We narrowed to 11,250 results for: streptococcus -(crispr) -(cas9)
-
Plasmid#78545PurposeFusion protein Cas9+BFPDepositorInsertBFP
UseLentiviralExpressionMammalianPromoterFusion protein with Cas9Available SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC-H1-gRNA
Plasmid#61089PurposeCRISPR/Cas9 system gRNA cloningDepositorInsertH1 promoter; gRNA sequences
UseCRISPR; /cas9 grna cloning vectorExpressionMammalianPromoterH1Available SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
Cas9m2
Plasmid#47314PurposeCas9 D10A+H840ADepositorInsertCas9m2
UseCRISPRAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMCSG7-Wt-NmeCas9
Plasmid#71474Purposebacterial pMCSG7 expression vector expressing Wildtype Nme cas9 with T7 promoter, N-terminal His tag and TEV siteDepositorInsertpMCSG7-WT-NmeCas9
Tags6HisExpressionBacterialAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
NM9-SpCas9-NLS3
Plasmid#128177PurposeExpresses R. toruloides codon-optimized SpCas9 under PGK1 promoterDepositorInsertSpCas9-NLS3
UseCRISPRExpressionYeastPromoterpPGK1Available SinceApril 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV9)
Viral Prep#112677-AAV9PurposeReady-to-use AAV9 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)Available SinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 BsaI gRNA
Plasmid#99698PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA with BsaI cloning sites for programming, vector allows for strong activation of programmed target gene, can be packaged and delivered as AAVDepositorTypeEmpty backboneUseAAVAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSEVA421-Cas9tr
Plasmid#138709PurposePlasmid constitutively expressing the Cas9 nuclease and the non-coding tracrRNA from S. pyogenesDepositorInserttracrRNA-Cas9
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCT-tRNA
Plasmid#133813PurposeCRISPR-Cas9 system for genetic manipulation of Candida tropicalisDepositorInsertcassette for the expression of the sgRNA from the Ashbya gossypii RNA pol II TEF1 promoter
UseCRISPRAvailable SinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRS415-Cas9-VPR
Plasmid#163971PurposeTrifunctional Cas9-VPR fusion protein plasmid for simultaneous transcriptional activation, transcriptional repression, and genome editing in yeastDepositorInsertCas9-VPR
UseSynthetic BiologyExpressionYeastAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
ER50-SpCas9-ER50
Plasmid#85448PurposeExpresses SpCas9 fused to ER50 domain on both N- and C-termini in mammalian cellsDepositorInsertER50-SpCas9-ER50
UseAAVTagsdestabilized domain of estrogen receptor ligand b…ExpressionMammalianPromoterCbhAvailable SinceFeb. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJW1285
Plasmid#61252PurposeCRISPR/Cas9 plasmid with sgRNA(F+E) targeting pha-1; for co-conversion in C. elegansDepositorInsertsgRNA(F+E) targeting pha-1
UseCRISPRExpressionWormAvailable SinceDec. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
BPK2301
Plasmid#65778PurposeHuman expression plasmid for S. thermophilus 1 Cas9 sgRNA (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-St1-sgRNADepositorInsertSt1Cas9 gRNA backbone, without spacer sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRGEB-Cas9-VirD2 (PCO)
Plasmid#139802PurposeExpressing Cas9-VirD fusion under ubiquitin promoterDepositorInsertCas9-VirD2
TagsCas9-VirD2ExpressionPlantPromoterUbiquitinAvailable SinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRGEB-VirD2-Cas9
Plasmid#139803PurposeExpressing VirD-Cas9 fusion under ubiquitin promoterDepositorInsertVirD2-Cas9
TagsVirD2-Cas9ExpressionPlantPromoterUbiquitinAvailable SinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZLCv2-3xFLAG-dCas9-HA-2xNLS
Plasmid#106357PurposeEmpty backbone for CRISPR/Cas9 engineered chromatin immunoprecipitationDepositorTypeEmpty backboneUseCRISPR and LentiviralTags3XFLAG and HAExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
vHB8
Plasmid#193454PurposeExpression of GFP-Cas9-NLS and gRNA in A. castellaniiDepositorInsertGFP-Cas9-NLS
UseCRISPRTagsGFPPromoterGAPDHAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
SpCas9 TadCBEd
Plasmid#193835PurposeExpress TadCBEd (with SpCas9) in mammalian cellsDepositorInsertTadA-CDd-SpCas9 D10A-2xUGI
ExpressionMammalianAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Adeno EA
Plasmid#64071PurposeAdenovirus for the expression of gRNAs targeting intron 19 of murine Alk and intron 14 of Eml4DepositorInsertU6_sgRNA(Alk)_U6_sgRNA(Eml4)_CBh_FLAG-Cas9
UseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only