27,007 results
-
Plasmid#193835PurposeExpress TadCBEd (with SpCas9) in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTadA-CDd-SpCas9 D10A-2xUGI
ExpressionMammalianAvailable sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CMV-Cas13X.1-SV40pA_U6-BbsI-DR_CMV-mCherry-BGHpA
Plasmid#171379PurposeExpression vector for encoding a human codon-optimized Cas13X.1 driven by CMV promoter,mCherry driven by CMV promoter and U6-driven crRNAs cloning site.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthumanized Cas13X.1
ExpressionMammalianPromoterCMV, U6Available sinceJuly 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1-PPARA
Plasmid#169019PurposeExpression of PPARA driven by CMV promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman ppara (PPARA Human)
ExpressionMammalianPromoterCMVAvailable sinceJune 14, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAGM47523
Plasmid#153221PurposeLevel 0 zCas9i vectorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpCas9 with introns and 2 NLS
UseSynthetic BiologyAvailable sinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
TfR-sfGFP-myc tag-SpyCatcher003
Plasmid#133451PurposeExpresses SpyCatcher003 for display at the cell surface of mammalian cells, with superfolder GFP for visualization and myc tag for antibody detectionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTfR-sfGFP-myc tag-SpyCatcher003
TagsGSSGS and myc tagExpressionMammalianMutationContains C20 and A23 mutations that improve plasm…PromoterCMVAvailable sinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pB-CAGGS-dCas9-KRAB
Plasmid#110822PurposePiggyBac compatible plasmid expressing dCas9-KRABDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCas9-KRAB
ExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…PromoterCAGGSAvailable sinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1 Dendra2
Plasmid#103967PurposeMammalian expression of fluorescent protein Dendra2 used for transfection efficiency controlDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDendra2
ExpressionMammalianAvailable sinceJuly 16, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAW63.YY1.FKBP.knock-in.BFP
Plasmid#104371PurposeFor knocking in FKBP F36V P2A BFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFKBP12(F36V) -P2A-BFP
Available sinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
DNA-PKcs T3950D
Plasmid#83320PurposeDNA-PKcs T3950ADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman DNA-PKcs (PRKDC Human)
ExpressionMammalianMutationActivation loop phosphorylation site 3950 substit…Available sinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLQ2817 pPB: CAG-PYL1-VPR-IRES-Puro-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9
Plasmid#84239PurposeExpresses ABA-inducible VPR-Sp dCas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsABI-tagBFP-Sp dCas9
PYL1-VPR
UseCRISPR and Synthetic Biology; PiggybacTags2xNLS (SV40), ABI, HA tag, IRES-Puro, PYL1, and t…ExpressionMammalianPromoterCAG and PGKAvailable sinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MSP2135
Plasmid#72248PurposeHuman expression plasmid for SpCas9-HF2 variant: CMV-T7-humanSpCas9-HF2(N497A, R661A, Q695A, Q926A, D1135E)-NLS-3xFLAGDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmammalian codon-optimized Streptococcus pyogenes Cas9 HF2(N497A/R661A/Q695A/Q926A/D1135E)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926A, and D1135EPromoterCMVAvailable sinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMito-rxRFP1.1
Plasmid#67841Purposeredox-sensitive red fluorescent protein rxRFP1.1, mitochondrially localizedDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertrxRFP1.1 and mitochondrial localization sequence
TagsHis Tag and mitochondrial localization sequenceExpressionMammalianPromoterCMVAvailable sinceOct. 9, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MSP680
Plasmid#65772PurposeHuman expression vector for SpCas9 EQR variant: CMV-T7-humanSpCas9(D1135E/R1335Q/T1337R)-NLS-3xFLAG (EQR variant)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135E/R1335Q/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135E, R1335Q, and T1337R mutations in Cas9PromoterCMV & T7Available sinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
HBx
Plasmid#65463Purposeexpresses HBx in mammalian cellsDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHBV X protein
TagsFlagExpressionMammalianAvailable sinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GFP-Rab4B
Plasmid#61801PurposeHuman Rab4B fluorescently tagged with GFP on the N-terminus for mammalian expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRab4B (RAB4B Human)
TagsGFPExpressionMammalianMutationNonePromoterCMVAvailable sinceJan. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-CHC17KDP
Plasmid#59799PurposeExpresses knockdown-proof human CHC17 tagged with GFP.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCHC17 (CLTC Human)
TagsGFPExpressionMammalianMutationSilent mutations in amino acids 61-65 to confer s…PromoterCMVAvailable sinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-calpainsensor
Plasmid#36182Purposedetection of activity of ubiquitous calpainsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertalpha-Fodrin cleavage site (Sptan1 Mouse)
TagseCFP and eYFPExpressionMammalianPromoterCMVAvailable sinceAug. 25, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
mEmerald-TGNP-N-10
Plasmid#54279PurposeLocalization: Golgi Complex, Excitation: 487, Emission: 509DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTGNP (TGOLN2 Human)
TagsmEmeraldExpressionMammalianPromoterCMVAvailable sinceJuly 10, 2014AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
GABA(A) receptor subunit a1SE
Plasmid#49168PurposepHluorin-tagged GABA A receptor subunit (alpha 1) produces minimal fluorescence during trafficking and a robust fluorescent signal at the cell surfaceDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGABA(A) receptor subunit alpha-1 (Gabra1 Mouse)
Tagsmyc and pHGFP (pHIuorin)ExpressionMammalianPromoterCMVAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by