32,684 results
-
Plasmid#247938PurposeExpression of human LONP1 with methionine 115 as its first residue (mature mitochondrial-matrix localized form) and Walker B mutant (E591A)DepositorInsertLONP1 (LONP1 Human)
Tags6xHisExpressionBacterialMutationencodes aa 115-959, with E591APromoterT7Available SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3-GST-Tev-Af1521(K35E/Y145R)-myc
Plasmid#196241PurposeN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site located between the GST tag and Af1521 and a myc tag on the C terminusDepositorInsertN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site between GST and Af1521 encoding a C-terminal myc tag
TagsGST tag and myc tagExpressionBacterialMutationamino acid 35 lysine is replaced with glutamic ac…Available SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
MZB053
Plasmid#217835PurposeBacterial expression of human AP3B1 (1-677) and AP3M1 AP-3 core hemicomplexDepositorTagsGSTExpressionBacterialMutationRemoved residues 678-1094 from AP3B1Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
WNV NS2B-NS3 protease (catalytically active, self cleave); aliases: West Nile Virus NS2B-NS3 fusion protein
Plasmid#204795PurposeBacterial expression of a fusion of West Nile NS2B-NS3 proteinsDepositorInsertWest Nile NS2B-NS3 fusion
ExpressionBacterialAvailable SinceAug. 29, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
NBla_1.2_EmrE_TMD4_3P_G90V_G97V
Plasmid#207847PurposeBLaTM-System; Antiparallel negativecontrol EmrE_TMD4_3P_G90V_G97V in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_EmrE_TMD4_3P
Plasmid#207846PurposeBLaTM-System; Antiparallel positive control EmrE_TMD4_3P in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_GpA_wt
Plasmid#207842PurposeBLaTM-System GpA wt positive control in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
CBLa_1.2_GpA_wt
Plasmid#207843PurposeBLaTM-System GpA wt positive control in CBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251_ Ptrc.x.tetO2::D-HicDH
Plasmid#185456PurposeCDS of D-HicDH codon optimized for expression in Synechocystis sp. PCC 6803 under the control of the synthetic promoter Ptrc.x.tetO2 and the RBS BBa_B0030 in pSEVA251 plasmid.DepositorInsertD-HicDH from Lactobacillus paracasei DSM 20008
ExpressionBacterialPromoterPtrc.x.tetO2Available SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB402-er-mCherry
Plasmid#186288PurposeBinary vector for the expression of er-mCherry (SP-mCherry-HDEL) in plants (for Agrobacterium-mediated genetic transformation and visualization of endoplasmic reticulum)DepositorInserter-mCherry
ExpressionBacterialAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTD103-ARG1
Plasmid#106475PurposeExpresses acoustic reporter genes or gas vesicles (ARG1) in Salmonella typhimuriumDepositorInsertARG1
UseSynthetic BiologyExpressionBacterialPromoterpLuxAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET Flag TEV LIC cloning vector (2L-T)
Plasmid#29715DepositorTypeEmpty backboneTagsFLAG-TEVExpressionBacterialAvailable SinceJune 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
pDD57
Plasmid#119882PurposeConstitutive expression of GFP+ on pAL5000/pMB1 backbone with kanamycin resistance.DepositorInsertpConstitutive_GFP+
ExpressionBacterialAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
Sperm whale Mb 64Y68F in pVP80K
Plasmid#86956PurposeIncreases expression of sperm whale myoglobin protein for making apomyoglobin as a reagent for measuring rates of hemin dissociation (as opposed to previous construct in pUC).DepositorInsertMb 64Y68F
ExpressionBacterialMutation64Y68FPromoterT5Available SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
GST-GGA3-VHS-GAT
Plasmid#173719PurposeVHS-GAT domain in GGA3 can bind to an active form of ARF1 protein. Using this construct, you can assess the activity of ARF1 protein.DepositorAvailable SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFGM1
Plasmid#64949Purposesource of GmR FRT cassetteDepositorInsertFRT-GmR-FRT
ExpressionBacterialAvailable SinceNov. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a Cdk2ap1CAN
Plasmid#178032PurposeExpression vector for the purpose of protein purification.DepositorInsertCdk2ap1 (Cdk2ap1 Mouse)
UseNonviralTags6xHIS - Thrombin - MBP- TEV-TRSExpressionBacterialPromoterT7LacIAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-GST-FBW7 alpha
Plasmid#197456PurposeThe plasmid expresses GST-tagged FBW7 human isoform 1. Used for in vitro translation of FBW7alpha.DepositorInsertFBW7 (FBXW7 Human)
UseIn vitro translationTagsGSTExpressionBacterialMutationSee depositor comments belowPromoterT7Available SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWaldo-GFPe-SH1446
Plasmid#112507PurposeExpresses SH1446 in E. coli with a C-terminal TEV-GFP-His(8) tag.DepositorInsertPOT family transporter
TagsC terminal TEV GFP octa-His affinity tagExpressionBacterialPromoterT7Available SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only