31,059 results
-
Plasmid#52631Purposebacterial expression vector with far-red FP mCardinal2DepositorInsertmCardinal2
ExpressionBacterialAvailable SinceApril 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pQLinkGD
Plasmid#13673DepositorInsertGateway cassette
UseCo-expressionTagsGSTExpressionBacterialAvailable SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBbB1a-GFP
Plasmid#35340DepositorInsertGFP
UseSynthetic BiologyExpressionBacterialPromoterTrcAvailable SinceMay 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
pExp-Bla
Plasmid#112561PurposeUsed for expression of protein in E. coli as TEV cleavable N-terminual 8His and Bla (beta-lactamase from the halophile Chromohalobacter sp. fusions with optional C-terminal StrepII-tagDepositorTypeEmpty backboneTags8xHis-Bla and Strep tagExpressionBacterialAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDT386
Plasmid#174733PurposeExpresses His-tagged DT386, a truncated diphtheria toxin without a receptor-binding domain.DepositorInsertDT386
TagsHistagExpressionBacterialMutationDeleted amino acids 412-560 (the receptor binding…PromoterT5Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPEPZ-sgRNAclone
Plasmid#141090PurposeThis vector is designed for efficient cloning of sgRNAs by Golden Gate assembly. The sgRNA insertion leads to replacement of mCherry, resulting in loss of red color of E. coli colony.DepositorInsertmCherry
UseCRISPRExpressionBacterialPromoterp3Available SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1-p19-T7
Plasmid#46306DepositorInsertsp19
DNA-1 site
linker
DNA-2 site
UsePro-sirnaTags6XHis and GSTExpressionBacterialPromoterTacAvailable SinceJuly 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
R701-X71-527: His6-tev-Hs.CALM1(1-80)
Plasmid#159694PurposeE. coli protein expression of His6-tev-Hs.CALM1(1-80)DepositorAvailable SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAD12
Plasmid#34832DepositorInsertNone
UseRNAiExpressionBacterialAvailable SinceJune 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHis-LMW_FGF2
Plasmid#157657PurposeExpresses FGF2 in E.coli cellDepositorInsertFibroblast growth factor 2 (FGF2 Human)
TagsHis tagExpressionBacterialMutationchanged Cystein 211,229 to serine, deleted amino …Available SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR4 hNFATc1-EE
Plasmid#17857DepositorAvailable SinceApril 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
p15aC-4D1D-5
Plasmid#107866PurposeBacterial expression of PIS, PI4K and PI4P5KDepositorInsertsPIS
phosphatidylinositol 4-phosphate 5-kinase
phosphatidylinositol 4-kinase β
TagsmycExpressionBacterialPromoterproD and proD (in operon)Available SinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNtCp-rbcL-PHLS-GPPS-aadA-accD
Plasmid#52471PurposeInserts the beta-phellandrene synthase gene, the geranyl diphosphate synthase gene, and aadA resistance in the rbcL-accD intergenic region in Nicociana tabacumDepositorInsertrbcL-PHLS-GPPS-aadA-accD
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET21b-MBPx-MBPx-SpyTag003
Plasmid#216291PurposeExpresses tandem MBPx linked to-SpyTag003 in bacterial cells. MBPx is a variant of MBP (A312V I317V Δ172-173 Δ175-176) with enhanced affinity for maltose.DepositorInsertMBPx-MBPx-SpyTag003
UseAffinity Reagent/ AntibodyTagsHis6 and SpyTag003ExpressionBacterialPromoterT7 promoterAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
Grp1-PH pGEX2TK
Plasmid#71379Purposebacterial expression of PH domain for phosphoinositide binding assayDepositorInsertGrp1-PH (Cyth3 Mouse)
TagsGSTExpressionBacterialMutationPleckstrin homology (PH) domain; aa 264-391PromotertacAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST-APLO
Plasmid#112805Purposegateway cloning destination vector to express LexAop2 driven transgene in DrosophilaDepositorTypeEmpty backboneExpressionBacterialAvailable SinceSept. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET14b His Rab8a Q67L
Plasmid#186014PurposeHis Rab8a Q67LDepositorInsertHis Rab8a Q67L (RAB8A Human)
ExpressionBacterialAvailable SinceSept. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
D. vulgaris Cascade/I-C (Cas5c-Cas8c-Cas7)/pHMGWA
Plasmid#81185PurposeExpresses Desulfovibrio vulgaris Cascade/I-C complex subunits in E. coli with TEV-cleavable N-terminal His-MBP tag on Cas5cDepositorInsertsCas5c
Cas8c
Cas7
UseCRISPRTags6xHis - MBP - TEV protease siteExpressionBacterialPromoterT7Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
HYG-TET-OFF – ubiquitin – LEU – 4FLAG
Plasmid#193315PurposeDoxycycline-induced transcriptional regulation and Ubiquitin - LEU - 4xFLAG N-terminal tagging. Ubiquitin is cleaved off, resulting in an unstable protein with an N-terminal leucine.DepositorInsertUbiquitin - Leucine - 4FLAG N-terminal tagging
Tags4FLAGExpressionBacterialAvailable SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only