We narrowed to 18,548 results for: MUT
-
Plasmid#128587PurposeAAV-mediated expression of ChrimsonR-tdTomato under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner. tdTomato has codons varied to reduce recombination.DepositorInsertChrimsonR-tdTomato
UseAAVTagstdTomato (codon diversified version)ExpressionMammalianMutationChrimson K176R mutantPromoterEF1α (1.1 kb short version)Available SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3 sgRNA(MS2)-MS2-AID3f
Plasmid#112129Purposeempty sgRNA cloning vector with MS2-AID3fDepositorInsertAIDmono 3f mutant (AICDA Human)
UseCRISPRExpressionMammalianMutationN- mutated and C- terminal truncated, F115Y/C116F…PromoterhU6,CBhAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLL2 sgRNA(MS2)-MS2-AID3c
Plasmid#112128Purposeempty sgRNA cloning vector with MS2-AID3cDepositorInsertAID mono 3c mutant (AICDA Human)
UseCRISPRExpressionMammalianMutationN- mutated and C- terminal truncated, F115Y/C116F…PromoterhU6,CBhAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
PA-DAD-dark
Plasmid#53096PurposeExpresses dark mutant PA-DAD in mammalian cells, an optogenetic tool to activate endogenous diaphanous related formins in live cells using light with LOV2 in the closed conformationDepositorInsertLOV(dark)-6aa-DAD
Tags6x His and mVenusExpressionBacterial, Insect, and Mamm…MutationL47F and C49S in Venus; C450M mutation in LOV2Available SinceAug. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-B.1.1.7
Plasmid#171747PurposeMammalian expression of SARS-CoV-2 Spike protein S-GSAS-B.1.1.7 variant (UK)DepositorInsertSpike (S-GSAS-B.1.1.7 variant) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceJuly 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
hSyn ArcLightCo (Q239)-T2A-nls-mCherry
Plasmid#85844PurposeGenetically encoded voltage sensor ArcLight- codon optimizedDepositorInsertArcLightCo-Q239
TagsmCherryExpressionMammalianMutationCi-VSP contains R217Q mutation; super ecliptic pH…PromoterhSyn1Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [ChrimsonR-GFP]
Plasmid#108273PurposeAAV-mediated expression of ChrimsonR-GFP under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterEF1α promoter (1.1kb short version)Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD E1368A
Plasmid#188141PurposeExpresses C-terminal flag-tagged human CAD E1368A in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD S1396A
Plasmid#188126PurposeExpresses C-terminal flag-tagged human CAD S1396A in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-FullLength-TET1-CXXC/LLAA
Plasmid#124399PurposeFull-length mutant TET1 (L897A/L900A), missing zinc finger domain (585-624), used to PiggyBAC rescue the function of TET1/2 DKO cellsDepositorInsertFLAG-FullLength-TET1 CXXC zinc finger deletion (585-624) and L897A/L900A mutations (TET1 Human)
TagsFlagExpressionMammalianMutationCXXC zinc finger deletion (aa 585-624) and L897A/…Available SinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-FLPX-rc [ChrimsonR-GFP]
Plasmid#118295PurposeAAV-mediated expression of ChrimsonR-GFP under the CAG promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterCAGAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-myc-AP1S3 F4C
Plasmid#58293Purposemammalian expression of AP1S3 F4C mutantDepositorInsertAP1S3 (AP1S3 Human)
Tags6xHis and mycExpressionMammalianMutationF4C: c.11T>G, p.Phe4CysPromoterCMVAvailable SinceAug. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-myc-AP1S3 R33W
Plasmid#58294Purposemammalian expression of AP1S3 R33W mutantDepositorInsertAP1S3 (AP1S3 Human)
Tags6xHis and mycExpressionMammalianMutationR33W: c.97C>T,p.Arg33TrpPromoterCMVAvailable SinceAug. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α1.1-FLPX-rc [ChrimsonR-GFP]
Plasmid#128588PurposeAAV-mediated expression of ChrimsonR-GFP under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterEF1α (1.1 kb short version)Available SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hNFATc2/C(RIT)-FLAG-AVITEV
Plasmid#74053Purposeretroviral expression plasmid for human NFATc2/C (with RIT mutation abrogating AP1 binding) with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc2, isoform C (NFATC2 Human)
UseRetroviralTagsAVI-TEV and FLAGExpressionMammalianMutationsilent mutation A1723C in the sequence of NM_1730…PromoterpMSCV-LTRsAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mIL6R
Plasmid#60797PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains IL6R 3' UTR and mutated miR-155 sitesDepositorInsertIL6R 3'UTR and mutated miR-155 binding site (IL6R Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMVblast_SLC38A2_N82A
Plasmid#156181PurposeCMV-driven expression of sgRNA-resistant SLC38A2 N82A mutant cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterCMVAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pInducer20_SLC38A2_N82A
Plasmid#156183PurposeDox-inducible expression of sgRNA-resistant SLC38A2 N82A mutant cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterTREAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-D614G-deltaFV
Plasmid#171743PurposeMammalian expression of SARS-CoV-2 Spike protein mink variant (S-GSAS-D614G-deltaFV variant)DepositorInsertSpike (S-GSAS-D614G-deltaFV variant) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV6 FLAG-DNAJC5 L115R
Plasmid#246742PurposeMammalian expression of human DNAJC5 with L115R mutation, and a FLAG tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsFLAGExpressionMammalianMutationL115RPromoterCMVAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6 FLAG-DNAJC5 delL116
Plasmid#246741PurposeMammalian expression of human DNAJC5 with L115R mutation, and a FLAG tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsFLAGExpressionMammalianMutationdelL116PromoterCMVAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12R-IRES-mCherry
Plasmid#221023PurposeFluorescent reporter for expressing the KRAS G12R mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12S-IRES-mCherry
Plasmid#221024PurposeFluorescent reporter for expressing the KRAS G12S mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12A-IRES-mCherry
Plasmid#221020PurposeFluorescent reporter for expressing the KRAS G12A mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12C-IRES-mCherry
Plasmid#221021PurposeFluorescent reporter for expressing the KRAS G12C mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12D-IRES-mCherry
Plasmid#221022PurposeFluorescent reporter for expressing the KRAS G12D mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)-mRuby2
Plasmid#215447PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorTagsmRuby2MutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB.DEST-ITGB1(YYFF)-mRuby2
Plasmid#215449PurposePiggybac expression vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseTransposon-based stable expressionTagsmRuby2ExpressionMammalianMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoterCAGAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
7AA-aSyn-pRK172
Plasmid#236197PurposeThis plasmid expresses human α-synuclein with a 7-amino acid insertion (MAAAEKT) in the pRK172 backbone for bacterial expression in E. coli. The insertion corresponds to the JOS mutation.DepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only