We narrowed to 9,360 results for: CAG
-
Plasmid#198419PurposeExpresses Human CASP9 Specific gRNA/Cas9 Complex and Reporter ProteinDepositorInsertHuman CASP9 Specific gRNA (CASP9 Human)
UseCRISPRTagsCas9/Orange Fluorescent Protein ReporterExpressionMammalianPromoterU6; CMVAvailable SinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
B52 + SMARCAL1 sgSTOP
Plasmid#100715PurposeB52 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
nCre-ST-NLS-P2A-NLS-pSC-cCre
Plasmid#207638PurposeA plasmid encoding N-terminal Cre fused to SpyTag (ST) and photocaged SpyCatcher (pSC) fused to C-terminal Cre with a nuclear localization signal (NLS) sequenceDepositorInsertnCre-SpyTag-NLS-P2A-NLS-photocaged SpyCatcher-cCre
ExpressionMammalianMutationAmber stop codon at SpyCatcher’s critical lysinePromoterCMVAvailable SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1C gRNA (BRDN0001145164)
Plasmid#77667Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1CDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PXPR007 sgATXN1L-1
Plasmid#74962PurposeCas9 + sgATXN1L-1 with blasticidin selectionDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PRKD1 gRNA (BRDN0001146537)
Plasmid#77228Purpose3rd generation lentiviral gRNA plasmid targeting human PRKD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MTOR gRNA (BRDN0001145868)
Plasmid#76784Purpose3rd generation lentiviral gRNA plasmid targeting human MTORDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-shGrm2-972
Plasmid#120724PurposeLentiviral vector that expresses GFP and an shRNA targeting Grm2 (in pLL3.7)DepositorAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
SIK3 gRNA (BRDN0001148297)
Plasmid#75755Purpose3rd generation lentiviral gRNA plasmid targeting human SIK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RIPK2 gRNA (BRDN0001146083)
Plasmid#76910Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_3
Plasmid#155083PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.TRC1.shmNsd1.2, puro
Plasmid#114447PurposeLentiviral vector for expression of shRNA sequence targeting mouse Nsd1DepositorInsertshNsd1.2 (Nsd1 Mouse)
UseLentiviral and RNAiAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.1_puro_shJUND #1
Plasmid#136581PurposeExpresses an inducible short hairpin targeting human JUND sequenceDepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA5 gRNA (BRDN0001145521)
Plasmid#77372Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA5DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 sgATXN1L-1
Plasmid#74970PurposesgATXN1L-1, puromycin selectionDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
B52 + PARP4 sgSTOP
Plasmid#100711PurposeB52 plasmid expressing PARP4 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting PARP4 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
PRKAA1 gRNA (BRDN0001147273)
Plasmid#76254Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
B52 + PIK3R1 sgSTOP
Plasmid#100714PurposeB52 plasmid expressing PI3KR1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting PIK3R1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrnb3-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128344PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
MPP1 gRNA (BRDN0001149326)
Plasmid#77804Purpose3rd generation lentiviral gRNA plasmid targeting human MPP1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKCD gRNA (BRDN0001147700)
Plasmid#76003Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCDDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PPIP5K1 gRNA (BRDN0001146986)
Plasmid#76307Purpose3rd generation lentiviral gRNA plasmid targeting human PPIP5K1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RET gRNA (BRDN0001149257)
Plasmid#77499Purpose3rd generation lentiviral gRNA plasmid targeting human RETDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 NDUFS6(5’UTR)-FF
Plasmid#85488PurposeFirefly luciferase under the control of NDUFS6 5'UTRDepositorAvailable SinceFeb. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1puro-shWillin-A
Plasmid#40885DepositorAvailable SinceNov. 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrambled-GFP
Plasmid#228736PurposeGFP expressing scramble of shRNA targeting Miro1DepositorAvailable SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shAtg7-EGFP
Plasmid#227684PurposeExpresses EGFP and shRNA targeting Atg7DepositorInsertAtg7 shRNA (Atg7 Mouse)
ExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d sgCiPELO #8
Plasmid#228934PurposeExpression of dCas9-KRAB and sgRNA targeting PELODepositorInsertPELO gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pColdI-SBP-DDX3_helicase_core
Plasmid#233622PurposeExpression of SBP-tagged helicase core region of DDX3X in E.coliDepositorAvailable SinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCV2 PQBP1 KO1
Plasmid#217447PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human PQBP1DepositorAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mouse cGAS #2-gRNA-Cas9-Puro
Plasmid#186891PurposegRNA targeting mouse cGAS (with Cas9 insert)DepositorInsertCas9 (Cgas Mouse)
UseLentiviralAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2703-AGER-gRNA2
Plasmid#216472Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(PRDM14_v32_7-6)-PGKpuroBFP-W
Plasmid#211983PurposeExpress gRNA against PRDM14 with puro and BFPDepositorInsertsgRNA targeting PRDM14 (PRDM14 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ACIN1_sgRNA2
Plasmid#201589PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertACIN1 (ACIN1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFDPS #1
Plasmid#198759Purposeconditional knockdown of FDPSDepositorInsertshFDPS #1 (FDPS Human)
ExpressionMammalianAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Flnc
Plasmid#174870PurposeCRISPR vector for generating Flnc STREAMING-tag KI cellDepositorInsertsgRNA for mouse Flnc (Flnc Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSpen#2/Cre
Plasmid#193240PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Spen geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgUbr5#2/Cre
Plasmid#173624PurposeExpresses a Ubr5-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ubr5 (Ubr5 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNf1#1/Cre
Plasmid#173607PurposeExpresses a Nf1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Nf1 (Nf1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_2
Plasmid#155066PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_1
Plasmid#155069PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_1
Plasmid#155073PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_1
Plasmid#155081PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_3
Plasmid#155067PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only