We narrowed to 27,248 results for: GFP
-
Plasmid#207721PurposeEmpty C-terminus donor cassette. Integrate homology arms to target the C-terminus insertion of a moxGFP-2A-Puro cassetteDepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pDEST47-ARF6-GFP
Plasmid#67394PurposeMammalian expression of hArf6 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-3xGFP-tDeg
Plasmid#191371PurposeOverexpression of 3xGFP-tDeg in human cellsDepositorInsert3xGFP-tDeg
Tags3xGFPExpressionMammalianAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
BiDi-[mp-mCherry2]mp-mEGFP
Plasmid#182871PurposeBi-directional expression vector of monomers with plasma membrane localization signalDepositorInsertmyr-palm-mCherry2, myr-palm-mEGFP
ExpressionMammalianAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pR6K-GFP-CASTIF
Plasmid#199653PurposeR6K plasmid encoding a type I-F CAST but no CRISPR arrayDepositorInsertCAST I-F systems
ExpressionBacterialPromoterJ23119 promoterAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-SP44-sfGFP
Plasmid#163757PurposeExpresses Streptomyces codon-optimised sfGFPDepositorInsertsfGFP
UseSynthetic BiologyTagsNoneExpressionBacterialPromoterSP44Available SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
aTY135_mtk02_pCAG-nfGFPtether_P2A_H2B-IRFP_SV40pA
Plasmid#225350Purposepiggyback backbone for non-fluorescent GFP tether and H2B-IRFP expressionDepositorInsertH2B (H2B Human, Synthetic)
TagsmiRFP and non-fluorescent GFP (Y67F)-P2AExpressionMammalianAvailable SinceDec. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
macroH2A2-GFP (pc2191)
Plasmid#223709PurposeExpression of macroH2A2 tagged N-terminal to GFPDepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-DVL1-WT
Plasmid#194586PurposeMammalian Expression of mEGFP-DVL1 WT Fusion ProteinDepositorAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-BioID-FAM21
Plasmid#121046PurposeExpresses GFP tagged BioID and human FAM21C in mammalian cellsDepositorInsertsTagsGFPExpressionMammalianMutationR118G (highly promiscuous form)PromoterCMVAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEFL EGFP-TEADi
Plasmid#140144PurposeTEAD inhibitor (TEADi): GFP-tagged inhibitor of the interaction of YAP1 and TAZ with TEAD transcription factors with nuclear localization signal.DepositorInsertEGFP TEADi
TagsEGFPExpressionMammalianPromoterEF1aAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-EGFP-ccdB
Plasmid#14323DepositorTypeEmpty backboneUseGateway CloningTagsEGFPExpressionYeastAvailable SinceJune 18, 2007AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-SS18-SSX1
Plasmid#237678PurposeFor overexpression of mEGFP-SS18-SSX1DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
scFLARE1-p2A-eGFP
Plasmid#158699PurposeMammalian expression of scFLARE1 component bearing a p2A-eGFP as transfection markerDepositorInsertscFLARE1-p2A-eGFP
UseAAVTagsFlag, V5. eGFPExpressionMammalianMutationTruncated form of TEV protease (220-242 amino aci…PromoterCMVAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
T5-pAc5.1 EGFP-EcoRV
Plasmid#206481PurposeSchneider cell imagingDepositorTypeEmpty backboneTagsEGFPExpressionInsectAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-GFP-SFPQ-RT
Plasmid#97090PurposeEncodes a HR repair template for knock-in of an EGFP insert that fused to the 5'-end of human SFPQ gene, without disturbing its promoter. Best used with px330-GFP-SFPQ vector.DepositorInsertEGFP-SFPQ-RT (SFPQ Human)
UseCRISPRAvailable SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
Septin 11 isoform II-EGFP
Plasmid#120316PurposeSeptin 11 isoform II mammalian expression (EGFP-tag at the C-terminus)DepositorAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-82:SON-mEGFP
Plasmid#133964PurposeHomology arms and mEGFP-linker sequence for N-terminus tagging of human SONDepositorInsertSON Homology Arms with mEGFP-linker (SON Human)
UseCRISPRTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceNov. 22, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
Ubi:ccdb-eGFP + RUBY
Plasmid#233310PurposeGATEWAY compatible vector with a soybean Ubiquitin (GmUbi) promoter driving in frame epitope fusion of eGFP paired with ccdb selection toxin and RUBY markerDepositorInsertUbi:ccdb-eGFP + RUBY
UseGateway CloningTagseGFPAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUGW-d2GFP-200
Plasmid#79602PurposeFUGW lentiviral vector with constiutively expressed destabilized GFP (d2GFP) regulated by 5 miR-200 family binding sitesDepositorInsertd2GFP + miR-200 family targets
UseLentiviralAvailable SinceJuly 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Pom121 GFP
Plasmid#187680PurposeIn vivo visualization of NPC protein Pom121DepositorAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-fNPY-GFP
Plasmid#22912DepositorInsertfugu neuropeptide Y promoter driving GFP
UseAAVExpressionMammalianAvailable SinceApril 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
pYES2-Ub-G76V-GFP
Plasmid#11954DepositorInsertUb-G76V-GFP
ExpressionYeastMutationUbiquitin fused to N-terminus of GFP. Glycine 76 …Available SinceMay 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCDNA_Lifeact-GFP_NLS-mCherry
Plasmid#69058PurposeDual Fluorescent Reporter for F-actin and NucleiDepositorInsertLifeAct-GFP_IRES_NLS-mCherry
TagsLifeact-GFP, NLS-mCherryExpressionMammalianPromoterCMVAvailable SinceDec. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330-GFP-SFPQ
Plasmid#97084PurposeEncodes an sgRNA that creates a DSB at the promoter of human SFPQ gene.DepositorInsertsgRNA GFP-SFPQ
UseCRISPRPromoterU6Available SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-GFP
Plasmid#66083PurposeG protein alpha-s internally tagged with EGFP and EE epitopeDepositorInsertG-alpha-s-EE-EGFP (Gnas Rat)
TagsEGFP flanked by SGGGS on each side was inserted i…ExpressionMammalianMutationBamHI sites in the alpha-s cDNA were removed and …PromoterCMVAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
p006-GFP-pBAD
Plasmid#108315PurposeGFP from jellyfish Aquorea sp. under pBAD promoter with AraC repressor; kanamycin resistant.DepositorInsertGFP under control of arabinose-inducible promoter pBAD
ExpressionBacterialPromoterpBADAvailable SinceAug. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBS-KS-attB1-2-PT-SA-SD-1-GFP11x7
Plasmid#172067PurposeProtein trap plasmid for inserting GFP11x7 into a phase 1 coding intronDepositorInsertGFP11x7
ExpressionInsectAvailable SinceOct. 20, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFX-mito-roGFP
Plasmid#174181PurposeExpress roGFP with mitochondria-targeting sequence in mammalian cellsDepositorInsertroGFP with mitchondria-targeting sequence
Tagsthe mitochondria-targeting sequence of the cytoch…ExpressionMammalianPromoterCMVAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMPRAv3:minP-GFP
Plasmid#109036PurposeMPRA v3 minimal promoter with GFP donorDepositorInsertemGFP
ExpressionMammalianPromoterminPAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-TO-nmdCas9-3XGFP
Plasmid#64109PurposeExpression of Nm dCas9-3XGFP in mammalian cellsDepositorInsertNm dCas9
UseCRISPR and LentiviralTags3XsfGFPExpressionMammalianPromoterCMV-TOAvailable SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAT9651-BEAR-GFP
Plasmid#162989PurposeBEAR target plasmid with split EGFP and disrupted 5' splice siteDepositorInsertEGFP split with an intron between amino acids 95-96
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) EGFP-Rac1(WT)
Plasmid#224278PurposeCell transfection and expression of Rac1DepositorInsertRac1 (RAC1 Human)
ExpressionMammalianAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSICO-eGFP-TNPO3
Plasmid#167590PurposeExpresses human TNPO3 fused to eGFPDepositorAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMRXIP GFP-SNAP29
Plasmid#45923DepositorAvailable SinceJuly 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
CMV-SNAP-hCB1_IRES_EGFP
Plasmid#223505PurposeExpression of CB1 N-terminally fused SNAP-tag, with targeting sequence to boost plasma membrane expression. Coupled with EGFP transfection markerDepositorAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-EGFP-GRAM1b
Plasmid#211702PurposeLentiviral expression of EGFP-tagged GRAM domain of GRAMD1b (pLJM1-EGFP-GRAM1b)DepositorInsertEGFP-tagged GRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
UseLentiviralTagsEGFPExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG1344 EGFP-FIREtag
Plasmid#205165PurposeExpresses EGFP-FIREtag in mammalian cellsDepositorInsertEGFP-FIREtag
ExpressionMammalianAvailable SinceSept. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBTK562 (pDS-GFP)
Plasmid#183129PurposeControl plasmid that expresses off-target dsRNADepositorInsertGFPmut3 (no RBS)
UseSynthetic BiologyAvailable SinceJuly 22, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMPMA3dPlac-PssaG-GFPLVA
Plasmid#23343DepositorInsertGFP(LVA)
TagsGFP(LVA)ExpressionBacterialAvailable SinceApril 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-35:AAVS1-mEGFP
Plasmid#91565PurposeHomology arms and linker-mEGFP sequence for internal insertion of CAGGS-mEGFP at the AAVS1 safe harbor location in human cells as a reporter for cytoplasmic mEGFPDepositorInsertAAVS1 Homology Arms with CAGGS driven mEGFP (AAVS1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterCAGAvailable SinceJune 7, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pmRNA-iSyn-EGFP
Plasmid#225907PurposeIn vitro transcription of cap-independently (synthetic IRES) translated mRNA encoding EGFP.DepositorInsertsPABP motif
HRV-B3-derived synthetic IRES
EGFP
HBA1 UTR
UseSynthetic Biology; Mrna preparationExpressionMammalianAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rab27B T23N
Plasmid#89450PurposeExpression of GFP-tagged human Rab27B T23N in mammalian cellsDepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pB-Halo,IRES-eGFP
Plasmid#164519PurposeAll-in-One piggyBac transposon Gateway Destination vector for dox-inducible expression of N-terminal Halo tagged protein (inducible GFP and constitutive rtTA and neomycin resistance)DepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-EGFP-p50
Plasmid#107977PurposeExpresssion of NF-kB p50DepositorInsertNF-kB p50 (Nfkb1 Mouse)
TagsN/AExpressionMammalianMutationAmino acids VQACI added to C-terminusPromoterCMVAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2(WT)-sfGFP
Plasmid#145171PurposeMammalian expression plasmid for soluble ACE2-super folder GFP fusionDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-GFP(0)-L1
Plasmid#205033PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertGFP(0)-L1
TagsGRRGKKSRK and MGHHHHHGGAExpressionBacterialMutationE16R, I138R, D207R, N222K, L246RAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pG14-MS2-GFP
Plasmid#27117DepositorInsertMS2-binding protein
TagsGFP, HA, and NLSExpressionYeastAvailable SinceDec. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
mPA-GFP-CD81-10
Plasmid#57124PurposeLocalization: Tetraspanin/Membrane, Excitation: 400 / 504, Emission: 515 / 517DepositorAvailable SinceFeb. 5, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits