We narrowed to 724 results for: Bacillus
-
Plasmid#129678PurposeGateway entry clone for CRISPR-Cas12b systemsDepositorInsertBthCas12b
UseCRISPR; Gateway compatible bthcas12b entry cloneExpressionPlantMutationE827A; BthCas12b is rice codon optimizedAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVR2-m4
Plasmid#84723PurposepVR2 but with G to U and A to C mutations following the riboswitch aptamerDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
ExpressionBacterialMutationG to U mutation at the first nucleotide after the…Available SinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVR2-m5
Plasmid#84724PurposepVR2 but with an insertion of 1 U immediately following the riboswitch aptamerDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
ExpressionBacterialMutationinsertion of 1 U between positions 39 and 40 of a…Available SinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVR2-m6
Plasmid#84725PurposepVR2 but with an insertion of 2 U's immediately following the riboswitch aptamerDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
ExpressionBacterialMutationinsertion of 2 Us between positions 39 and 40 of …Available SinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVR2-m7
Plasmid#84726PurposepVR2 but with a G to U mutation immediately following the riboswitch aptamerDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
ExpressionBacterialMutationG to U mutation at position 41 of annotated "…Available SinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVR2-m8
Plasmid#84727PurposepVR2 but with two G to U mutations immediately following the riboswitch aptamerDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
ExpressionBacterialMutationG to U mutations at positions 40 and 41 of annota…Available SinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVR2
Plasmid#84719PurposeE. coli RecA promoter followed by stretch with no A's followed by riboswitch for single-round transcriptionDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
ExpressionBacterialMutation12 nt stretch lacking A's inserted before 5&…Available SinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
p1G108CFa
Plasmid#85089PurposeExpresses PCNA1 variant (G108C) fused to an FAD domain of P450 BM3 (A74G/C773S/C810S) in E. coliDepositorInsertThe G108C variant of PCNA1 fused to an FAD domain of P450 BM3
TagsHis6 tagExpressionBacterialMutationG108C in PCNA1, A74G/C773S/C810S in FAD domain of…PromoterT7 promoterAvailable SinceNov. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVRa31_34
Plasmid#49687DepositorInsertECF31_34
UseSynthetic BiologyTagsHis6-PreScissionExpressionBacterialMutationCodon optimized for E.coliPromoterpT7-lacOAvailable SinceJan. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVRa30_35
Plasmid#49685DepositorInsertECF30_35
UseSynthetic BiologyTagsHis6-PreScissionExpressionBacterialMutationCodon optimized for E.coliPromoterpT7-lacOAvailable SinceJan. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVRc31_34
Plasmid#49747DepositorInsertAS31_34
UseSynthetic BiologyExpressionBacterialMutationCodon optimized for E.coliPromoterpLuxAvailable SinceJan. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVRc30_35
Plasmid#49746DepositorInsertAS30_35
UseSynthetic BiologyExpressionBacterialMutationCodon optimized for E.coliPromoterpLuxAvailable SinceJan. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAB051e
Plasmid#79195PurposeDirected Evolution of Protein-Protein InteractionsDepositorInsertPExt-10cons lambda op-62 gIII, luxAB; Ptet lambda cI-SH2ABL1
ExpressionBacterialPromoterPExt-10cons lambda op-62; PtetAvailabilityAcademic Institutions and Nonprofits only -
pAB078d7
Plasmid#79205PurposeDirected Evolution of Protein-Protein InteractionsDepositorInsertPlacZ-opt (off-target) luxAB; Ppro1 434cI-SH2ABL1
ExpressionBacterialPromoterPlacZ-opt (off-target); Ppro1AvailabilityAcademic Institutions and Nonprofits only -
pAB085e
Plasmid#79212PurposeDirected Evolution of Protein-Protein InteractionsDepositorInsertPlacZ-opt (OR1) luxAB; Ptet 434cI-TnTBR3-F7
ExpressionBacterialPromoterPlacZ-opt (OR1); PtetAvailabilityAcademic Institutions and Nonprofits only -
pSP6-RNAP
Plasmid#48143PurposeShuttle vector E. coli/B.meg.; encoding the RNA polymerase of the phage SP6 under control of the xylose inducible promoter PxylADepositorInsertrna polymerase SP6
UseSynthetic BiologyExpressionBacterialMutationV314A (numbering based on NCBI Sequence ID: NP_85…Available SinceOct. 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-BSR-GFP11
Plasmid#68716PurposeSplit GFP assayDepositorInsertbsr
UseRetroviralTagsFLAG and GFP11ExpressionMammalianAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCgVchCAST-crtYf
Plasmid#203816PurposeExpression of CRISPR-associated transposases, shuttle vector for Corynebacterium glutamicum / E. coliDepositorInsertVchTniQ, VchCas5/8, VchCas7, VchCas6, VchTnsABC, CRISPR(crtYf)
UseCRISPRExpressionBacterialAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-mNaChBac-P2A-EGFP
Plasmid#176280PurposeViral vector for co-expression of NaChBac and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertmNaChBac-P2A-EGFP
UseAAV and Cre/LoxExpressionMammalianPromoterhuman Synapsin IAvailable SinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pT7-soxA
Plasmid#190057PurposeExpress the bacterial monomeric sarcosine oxidase enzyme under the control of the strong constitutif phage promoter T7DepositorInsertSoxA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-agrBD-IV
Plasmid#53440PurposeDerivative of pT7-agrBD-I with a point mutation in the agrD gene to change AIP coding region from type-I to type-IVDepositorInsertagrBD locus (with D29Y mutation in agrD)
UseSynthetic BiologyTagsV5 epitope, 6x HIS (not expressed on agrB or agrD…ExpressionBacterialMutationD to Y mutation of residue 29 of the agrD gene (c…PromoterT7-lacAvailable SinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
SBC015869
Plasmid#226281PurposeExpresses MsCAD from trc promoter; expresses BsSfp and SrCAR from a separate trc promoter. Biosynthesis of (hydroxy)cinnamyl alcohols from (hydroxy)cinnamic acids.DepositorInserts4'-phosphopantetheinyl transferase Sfp
Cinnamyl alcohol dehydrogenase
Carboxylic acid reductase
ExpressionBacterialAvailable SinceNov. 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJT175_GalL_A3A(Y130F)Δ186-BE3
Plasmid#145124PurposeExpressing base editor A3A(Y130F)Δ186-BE3 in yeast cellsDepositorInsertA3A(Y130F)Δ186-BE3
UseCRISPRExpressionYeastMutationA3A(Y130F; 1-186AA); spCas9(D10A)PromoterGalLAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ291-D573A-SRDX
Plasmid#129683PurposeGateway entry clone for CRISPR-Cas12b systemsDepositorInsertBthCas12b-SRDX
UseCRISPR; Gateway compatible bthcas12b entry cloneExpressionPlantMutationD573A; BthCas12b is rice codon optimizedAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3R112C/T180CHFm
Plasmid#85091PurposeExpresses PCNA3 variant (R112C/T180C) fused to heme-FMN domain of P450 BM3 variant (A74G) in E. coliDepositorInsertThe R112C/T180C variant of PCNA3 fused to Heme-FMN domain of P450 BM3
TagsHis6 tagExpressionBacterialMutationR112C/T180C in PCNA3, A74G in heme-FMN domain of …PromoterT7 promoterAvailable SinceDec. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOpen-Bstpol
Plasmid#165543PurposeFull length DNA polymerase from Bacillus stearothermophilus.DepositorInsertBst DNA Polymerase, Full Length
UseSynthetic BiologyAvailable SinceAug. 9, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pST39-pNL29
Plasmid#91696PurposeExpresses Mega GVs in E.ColiDepositorInsertMega GV gene cluster (from pNL29) in pST39 backbone
TagsNo tagsExpressionBacterialPromoterT7Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBbA5a-sufCDSUB
Plasmid#195055PurposeExpresses SUF operon from B. subtilis from IPTG-inducible promoterDepositorInsertsufCDSUB
ExpressionBacterialAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKD279.8
Plasmid#173171PurposeEncodes expression of SO_4388(REC)-PsdR(DBD) 137 and an sfGFP reporterDepositorInsertsSO_4388(REC)-PsdR(DBD) 137
sfGFP
ExpressionBacterialPromoterJ23108 and PpsdA110Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET42b-BE3
Plasmid#87437PurposeExpresses BE3-NLS with an N-terminal His Tag (His6) for bacterial expressionDepositorAvailable SinceJune 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCWori cytochrome P450-BM3h 9D7
Plasmid#61308PurposeExpresses Cytochrome P450-BM3h 9D7 with C-terminal 6-His tagDepositorInsertCytochrome P450-BM3 heme domain 9D7
Tags6xHisExpressionBacterialMutationT268A, I263A, T438V, A328GPromoterTacAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-EcTyr-TAG
Plasmid#228782PurposeEcTyr aaRS/tRNA system for mammalian ncAA incorporationDepositorInsertsEcTyrRS
EcYtR
BstR
UseBaculoviralExpressionMammalianMutationTAG suppressorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28:LanIII-43
Plasmid#225077PurposeExpresses precursor peptide and lanthipeptide synthetase from LanIII-43 (FAST-RiPPs) in E. coliDepositorInsertLanA (LanIII-43)
TagsHis6ExpressionBacterialMutationWTPromoterT7Available SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
BE3-P2A-EGFP (pJUL977)
Plasmid#123612PurposeCAG promoter expression plasmid for rAPOBEC1-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP.DepositorInsertBE3-P2A-EGFP
ExpressionMammalianMutationD10A in SpCas9PromoterCAGAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYTRW26K_1Ti1
Plasmid#177292Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon/SacB with TcR and eYFPDepositorInsertPsacB-sacB
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a-HIS-Xyl-Xmod-DocIII
Plasmid#60865PurposeCharacteristic fingerprint molecule fused to dockerin type III domain to perform single molecule force spectroscopy experiments; covalently immobilized via introduced Cystein in Xylanase T120CDepositorInsertsXyl
Xmod-DocIII
Tags6xHISExpressionBacterialMutationThreonine 120 to Cysteine in Xylanase domainPromoterT7Available SinceNov. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
hA3A-BE3 (pRZ215)
Plasmid#131314PurposeCAG promoter expression plasmid for hA3A-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP.DepositorInserthA3A-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable SinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
eA3A-BE3 (pRZ206)
Plasmid#131315PurposeCAG promoter expression plasmid for hA3A(N57G)-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP.DepositorInserthA3A(N57G)-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable SinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
nCas9-UGI-NLS-P2A-EGFP (pJUL1001)
Plasmid#123611PurposeCAG promoter expression plasmid for hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP (BE3 control without rAPOBEC1).DepositorInsertnCas9-UGI-NLS-P2A-EGFP
ExpressionMammalianMutationD10A in SpCas9PromoterCAGAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only