We narrowed to 558 results for: Tore
-
Plasmid#164428PurposeAAV plasmid expressing TGFB2 in photoreceptorsDepositorAvailable SinceMarch 10, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pZH517
Plasmid#102670PurposeTetracycline inducible expression of GFPmut2 using autoregulation; strong ribosome binding site; GFPmut2 ORF can be replaced with gene of interest by isothermal assemblyDepositorInsertGFPmut2
ExpressionBacterialAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZH519
Plasmid#102672PurposeTetracycline inducible expression of GFPmut2 using autoregulation; moderate ribosome binding site; GFPmut2 ORF can be replaced with gene of interest by isothermal assemblyDepositorInsertGFPmut2
ExpressionBacterialAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZH518
Plasmid#102671PurposeTetracycline inducible expression of GFPmut2 using autoregulation; weak ribosome binding site; GFPmut2 ORF can be replaced with gene of interest by isothermal assemblyDepositorInsertGFPmut2
ExpressionBacterialAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-RGR-r10
Plasmid#74370PurposeThis plasmid constitutively expresses gRNA-r10 from an AHD1 promoter using the RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r10
UseCRISPR and Synthetic BiologyExpressionYeastPromoterADH1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pZH509
Plasmid#102664PurposeTetracycline inducible expression of GFPmut2 using bicistronic autoregulation; strong ribosome binding site; GFPmut2 ORF can be replaced with gene of interest by isothermal assemblyDepositorInsertGFPmut2
ExpressionBacterialAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-iRGR-r11
Plasmid#74369PurposeThis plasmid constitutively expresses gRNA-r11 from an AHD1 promoter using the insulated RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r11
UseCRISPR and Synthetic BiologyExpressionYeastPromoterAHD1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-hRedOpsin-TGFB3
Plasmid#164429PurposeAAV plasmid expressing TGFB3 in photoreceptorsDepositorAvailable SinceFeb. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZH512
Plasmid#102666PurposeTetracycline inducible expression of GFPmut2 using bicistronic autoregulation; moderate ribosome binding site; GFPmut2 ORF can be replaced with gene of interest by isothermal assemblyDepositorInsertGFPmut2
ExpressionBacterialAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pZH511
Plasmid#102665PurposeTetracycline inducible expression of GFPmut2 using bicistronic autoregulation; weak ribosome binding site; GFPmut2 ORF can be replaced with gene of interest by isothermal assemblyDepositorInsertGFPmut2
ExpressionBacterialAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-RO1.7-dnHIF
Plasmid#206343PurposeAAV plasmid expressing dominant negative HIF1A in photoreceptorsDepositorInsertdominant negative hif1a
UseAAVMutationdominant negative HIF1APromoter1.7kb human red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-shNC
Plasmid#206356PurposeAAV plasmid expressing non-targeting control shRNA in photoreceptorsDepositorInsertNon-targeting control shRNA
UseAAVPromoterhuman red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJMC-L2-Reverse-Donor-BsaI
Plasmid#197843PurposeDonor vector to restore L2 destination via BsaI (reverse orientation)DepositorInsertNone
UseUnspecifiedAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJMC-L2-Reverse-Donor-Esp3I
Plasmid#197844PurposeDonor vector to restore L2 destination via Esp3I (reverse orientation)DepositorInsertNone
UseUnspecifiedAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4 myc PGC-1 alpha
Plasmid#10974PurposeMammalian expression of PGC-1a with myc and his tagsDepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-Atg7
Plasmid#24921DepositorAvailable SinceJune 10, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCMV flag ERR alpha
Plasmid#10975DepositorAvailable SinceNov. 23, 2005AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AC EJ7-GFP
Plasmid#113617PurposeReporter for canonical-NHEJ. Reporter for end joining between two double-strand breaks, induced with the 7a and 7b sgRNAs with CAS9. EJ between the distal ends w/o indel mutations restores GFPDepositorInsertEJ7-GFP variant of EGFP
ExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AC 4-μHOM
Plasmid#113619PurposeReporter for Alt-EJ, variant of EJ7-GFP. Double strand breaks are induced with the 7a & 7h, or 7a & 7i sgRNAs, with CAS9. EJ using 4 nt of microhomology causes a deletion mutation and restores GFPDepositorInsert4-μHOM variant of EGFP
ExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-hRedOpsin-TGFB1
Plasmid#164427PurposeAAV plasmid expressing TGFB1 in photoreceptorsDepositorAvailable SinceNov. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-Atg5
Plasmid#24922DepositorAvailable SinceJune 10, 2010AvailabilityAcademic Institutions and Nonprofits only -
AAV-hRedOpsin-mCherry
Plasmid#164426PurposeAAV plasmid expressing mCherry in photoreceptorsDepositorInsertmCherry
UseAAVExpressionMammalianPromoterhuman red opsinAvailable SinceNov. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-Txnip(C247S)
Plasmid#206341PurposeAAV plasmid expressing mutant TXNIP in photoreceptorsDepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-nt.Txnip(C247S)(1-301aa)
Plasmid#206354PurposeAAV plasmid expressing deltion and mutant TXNIP in photoreceptorsDepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
GST-prRDH-CTS
Plasmid#86069PurposeA bacterial expression plasmid encoding photoreceptor retinol dehydrogenase ciliary targeting signal with N-terminus GST-tag.DepositorInsertRetinol dehydrogenase (RDH8 Bovine)
TagsGSTExpressionBacterialMutationthe insert is 297-312 of RDH8 (Bos taurus)PromotertacAvailable SinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
OpenLoopControl
Plasmid#59895Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Does not contain the target containing Vamp3 3′UTRDepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPESTExpressionMammalianPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N3-TPC2
Plasmid#80153PurposeIntracellular Ca2+ store markerDepositorAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-LC3 (human)
Plasmid#24920PurposeMammalian expression of LC3 fused to EGFPDepositorAvailable SinceJune 10, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-LC3 (Atg8)
Plasmid#24919DepositorAvailable SinceJune 10, 2010AvailabilityAcademic Institutions and Nonprofits only -
AAV-RO1.7-RPE65
Plasmid#206346PurposeAAV plasmid expressing RPE65 in photoreceptorsDepositorInsertRpe65 (Rpe65 Mouse)
UseAAVMutation450-Met (C57BL6 natural variation)Promoter1.7kb human red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
hEGFR-mEGFP
Plasmid#182878PurposeMammalian expression of epidermal growth factor receptor (EGFR) fused to mEGFPDepositorInserthEGFR-mEGFP (EGFR Human)
ExpressionMammalianAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-RO1.7-Lrat
Plasmid#206345PurposeAAV plasmid expressing LRAT in photoreceptorsDepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgFFL
Plasmid#59877Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene.DepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1-MBP-NAAEF-PNR(217-410 C275)-His6
Plasmid#177849PurposeBacterial Expression of PNRDepositorInsertphotoreceptor cell-specific nuclear receptor (NR2E3 Human)
Tags6xHis and MBPExpressionBacterialAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-RRAR
Plasmid#164569PurposeSARS-CoV-2 Spike protein with Furin site restored (S-RRAR variant)DepositorInsertSpike (S-RRAR variant)
Tags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT2/CMV-eGFP.PB/PTK
Plasmid#170540PurposeExpresses the puromycin resistance gene fused to a thymidine kinase, upon excision of this cassette the reading frame of eGFP is restoredDepositorInsertDelta 5'-eGFP CMV-PuroTK- Delta 3'-eGFP
ExpressionMammalianAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_3x_siRNA
Plasmid#59893Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with three siRNA-like sitesDepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--has three siRNA-like targets (fully c…Promoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-RO1.7-Hsp90ab1-FLAG
Plasmid#206355PurposeAAV plasmid expressing FLAG-tagged HSP90AB1 in photoreceptorsDepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d23
Plasmid#59892Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with two seed sites mutatedDepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd and fourth seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d3
Plasmid#59891Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with one seed site mutated.DepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGCaMP6m-N3-TPC2
Plasmid#80147PurposeGCaMP6 is a genetically encoded fluorescent Ca2+ sensor . TPC2-GCaMP6 allows the visualization of Ca2+ release from intracellular Ca2+ stores in real timeDepositorAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV_T7-PE2-Nuclease
Plasmid#171997PurposeSequence provided for PE-Nuclease mRNA transcription, suitable for microinjectionDepositorInsertCMV_T7-Cas9-RT
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-RRAR/D614G
Plasmid#164570PurposeSARS-CoV-2 Spike protein with D614G mutation and Furin site restored (S-RRAR-D614G variant)DepositorInsertSpike (S-RRAR-D614G variant)
Tags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationD614GAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-hRedOpsin-fCD200
Plasmid#164425PurposeAAV plasmid expressing full-length CD200 in photoreceptorsDepositorAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease
Plasmid#176528PurposeDelivers all prime editing nuclease components in a single plasmidDepositorInsertCbH-Cas9-RT, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
UseCRISPRExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCbH for Cas9, hU6 for gRNAsAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_7x_Bulge
Plasmid#59894Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with seven bulge target sitesDepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--has seven bulge targets (fully comple…Promoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CDreV
Plasmid#140133Purposecan be used to generate AAV virus that will express fusion protein of split Dre (C-terminal) and fungal photoreceptor Vivid (VVD) monomerDepositorInsertCDreV
UseAAVPromoterEF1aAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV10-Flag-Ovtm
Plasmid#51888Purposeexpression vectore in mammalian cellsDepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only