We narrowed to 7,550 results for: aav
-
Plasmid#107549Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression IRES-hrGFPDepositorTypeEmpty backboneUseAAVAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pAAV CB6 FFLuc-miR122
Plasmid#35656DepositorAvailable SinceApril 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn1 ChR2 ET-TC 2A tDimer
Plasmid#101361PurposeHigh efficiency channelrhodopsin, neuron specific promoter, red fluorescent proteinDepositorInsertsChannelrhodopsin-2
synaptophysin-red fluorescent protein
UseAAVExpressionMammalianMutationE123T , T159CPromoterhuman SynapsinAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro Xlone SOX17
Plasmid#179838PurposeDoxycycline-inducible expression of human SOX17DepositorInsertSOX17 (SOX17 Human)
UseAAV, CRISPR, Synthetic Biology, and TALEN ; Donor…ExpressionMammalianPromoterTRE3GSAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTBL437 AAVS1 EQR sgRNA
Plasmid#126447PurposeTo cut the human AAVS1 locus for integration.DepositorInsertspacer against human AAVS1 safe-harbor locus with NGAG PAM
ExpressionMammalianPromoterhuman U6Available SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap-FLEX.SF-Venus-iGluSnFR.A184S
Plasmid#106183PurposeTight affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorHas ServiceAAV1InsertSF-Venus-iGluSnFR.A184S
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184SPromoterhSynapsinAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN_mMaroon-KIX-mMaroon
Plasmid#137009PurposeAAV backbone, mMaroon-KIX acceptor for R-CREBDepositorAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-PGD2-1.1
Plasmid#214764PurposeAAV packaging plasmid for GRAB PGD2-1.1 fluorescent sensor under EF1alpha promoterDepositorInsertGRAB-PGD2-1.1 sensor
UseAAVPromoterEF-1-alpha promoterAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Fos YFP MS2
Plasmid#131775PurposeFos upstream msfYFP 24xMS2 Fos downstream for CRISPR taggingDepositorInsertmsfYFP - 24x MS2 loops
UseAAV and CRISPRPromotern/aAvailable SinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_UCN1.0
Plasmid#208668PurposeExpresses the genetically-encoded fluorescent urocortin (UCN) sensor GRAB_UCN1.0 in neuronsDepositorInsertGPCR activation based urocortin (UCN) sensor GRAB_UCN1.0
UseAAVPromoterhSynAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfaABC1D-DreO-4x6T
Plasmid#196413PurposeAstrocytic expression of Dre recombinase in AAV; astrocyte specificity enhanced with 4x6T miRNA targeting cassetteDepositorInsertDreO
UseAAV; Astrocyte-selectiveExpressionMammalianPromoterCAG and GfaABC1DAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP301-pAAV-CMV-MCS3-pA
Plasmid#113676PurposeCMV driven Multi Cloning Site-3DepositorInsertN/A
UseAAVPromoterCytomegalo Virus(CMV)Available SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVPromoterTREAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-JEDI-1P-WPRE
Plasmid#202616PurposeGenetically encoded voltage indicator (GEVI) JEDI-1P in AAV production vector for astrocytes specific expression using the promoter GFAPDepositorInsertJEDI-1P
UseAAVExpressionMammalianPromoterGFAPAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-SYN-GFP-BGHpA
Plasmid#190229PurposeExpresses EGFP in neuronal cellsDepositorInsertEGFP
UseAAVExpressionMammalianAvailable SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6sgp53-mTSG-GFAPCre
Plasmid#100276PurposeAAV-CRISPR library for pool mutagenesis of top tumor suppressor genesDepositorUseAAV, CRISPR, Mouse Targeting, and Synthetic Biolo…ExpressionMammalianAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV Ef1a-mRuby3-WPRE
Plasmid#135427PurposeCan be used to express mRuby3. Can also be used to create adeno-associated virus for delivery of the mRuby3 sequence.DepositorInsertmRuby3
UseAAVExpressionMammalianPromoterEf1aAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iATPSnFR2.A95K.HaloTag
Plasmid#209660PurposeExpression of iATPSnFR2, medium affinityDepositorInsertiATPSnFR2.A95K.HaloTag
UseAAVMutationA95KPromoterGFAPAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-mScarlet-I-Cdt1
Plasmid#191100PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsertmScarlet-I-Cdt1 (30-120)
UseAAV and Synthetic BiologyTagsmScarlet-I fused to residues 30-120 of human Cdt1…ExpressionMammalianMutationOptimized to human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only