We narrowed to 1,494 results for: U6 promoter
-
Plasmid#68433PurposeGeneral Purpose cloning vector for "INT"-like constructs under U6-promoter expression.DepositorInsertINT construct
UseCRISPR; Cloning vector for generating int-like co…ExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-U63-tgRNA-nlsBFP
Plasmid#169029PurposegRNA-marker vector contain a U6:3 promoter, gRNA scaffold, and a Ubi-mTagBFP-NLS marker.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterU6:3Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIK198
Plasmid#65629Purpose"flipped and extended" sgRNA backbone (Chen et al., 2013) following a C. elegans U6 promoter (Friedland et al., 2013). For Gibson cloning locus-specific sgRNA sequences.DepositorTypeEmpty backboneUseCRISPRExpressionWormPromoterU6Available SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRUSH
Plasmid#54479PurposeMouse genomic ROSA26 targeting vector, expresses EGFP, U6promoter to drive short RNAs, pgkneo, cassette flanked by loxP sitesDepositorTypeEmpty backboneUseCre/Lox, Mouse Targeting, and RNAiTagsSA-EGFP-polyA, U6 promoter, loxP, and pgk-neoExpressionMammalianPromoterU6Available SinceAug. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_sgRNA
Plasmid#68422PurposeTransient expression of a minimal sgRNA targeting the GLuc reporter, in mammalian cells. U6 promoterDepositorInsertGluc sgRNA
UseCRISPRExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-U63-tgRNA-Gal80
Plasmid#169030PurposegRNA-marker vector contain a U6:3 promoter, gRNA scaffold, and a Ubi-Gal80 marker.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterU6:3Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 neo
Plasmid#13425Purpose3rd gen lentiviral backbone for cloning and expression of new shRNA sequences. Uses neomycin for selection.DepositorInsertnon-hairpin 18bp
UseLentiviral and RNAiExpressionMammalianPromoterU6 promoterAvailable SinceDec. 22, 2006AvailabilityAcademic Institutions and Nonprofits only -
LeGO-iT
Plasmid#27361DepositorInsertU6 promoter, SFFV promoter, IRES-tdTomato
UseLentiviralExpressionMammalianAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
LeGO-G
Plasmid#27347DepositorInsertU6 promoter, SFFV promoter, eGFP
UseLentiviralExpressionMammalianAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
LeGO-C
Plasmid#27348DepositorInsertU6 promoter, SFFV promoter, mCherry
UseLentiviralExpressionMammalianAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
LeGO-E
Plasmid#27359DepositorInsertU6 promoter, SFFV promoter, EmeraldGFP
UseLentiviralExpressionMammalianAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
LeGO-T
Plasmid#27349DepositorInsertU6 promoter, SFFV promoter, tdTomato
UseLentiviralExpressionMammalianAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
LeGO-Cer
Plasmid#27351DepositorInsertU6 promoter, SFFV promoter, Cerulean
UseLentiviralExpressionMammalianAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
LeGO-X
Plasmid#27356DepositorInsertU6 promoter, SFFV promoter, dsRedExpress
UseLentiviralExpressionMammalianAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
LeGO-V
Plasmid#27350DepositorInsertU6 promoter, SFFV promoter, Venus
UseLentiviralExpressionMammalianAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
LeGO-Y
Plasmid#27357DepositorInsertU6 promoter, SFFV promoter, eYFP
UseLentiviralExpressionMammalianAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
LeGO-R
Plasmid#27355DepositorInsertU6 promoter, SFFV promoter, dsRed2
UseLentiviralExpressionMammalianAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
LeGO-1xT
Plasmid#27352DepositorInsertU6 promoter, SFFV promoter, dTomato
UseLentiviralExpressionMammalianAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
mPLD3-sgRNA-Cas9-mcherry
Plasmid#199700Purposeencodes sgRNA for mouse PLD3 KO, (target 217-223aa) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterU6 promoterAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideFE-Puro
Plasmid#170069PurposeExpresses S. pyogenes CRISPR chimeric RNA element (with F+E modifications) with customizable gRNA from U6 promoter and puromycin resistance from EFS-NS promoterDepositorInsertCas9 guide RNA scaffold with the F+E scaffold modification
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Std_BFP-to-EGFP_Dual_epegRNA_tevopreQ1
Plasmid#187459PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 pegRNA and EBFP_To_EGFP epegRNA (tevopreq1) from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP epegRNA (tevopreq1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-RfxCas13d-SV40pA_U6-BbsI-DR_CMV-mCherry-BGHpA
Plasmid#171380PurposeExpression vector for encoding a human codon-optimized RfxCas13d driven by CMV promoter,mCherry driven by CMV promoter and U6-driven crRNAs cloning site.DepositorInserthumanized RfxCas13d
TagsHAExpressionMammalianPromoterCMV, U6Available SinceJuly 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 1
Plasmid#51760PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 1
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 2
Plasmid#51761PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 2
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUC119-gRNA
Plasmid#52255PurposeCan use a PCR template to assemble new desired guide RNA. Contains an Arabidopsis U6 promoter to drive guide RNA (targeting AtPDS3 gene target site 1) expression with a TTTTTT as terminator.DepositorInsertguide RNA targeting AtPDS3 (PDS3 Mustard Weed)
UseCRISPR; Plant expressionPromoterArabidopsis U6 polymerase III promoterAvailable SinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
MSCV p2GM AMPK alpha2hp1 alpha1hp1
Plasmid#89492PurposeshRNA against AMPK alpha2 and alpha1 in mouse/human to knock down protein expressionDepositorInsert2 hairpins against mouse/human AMPKalpha1 and alpha2
UseRetroviralExpressionMammalianPromoterU6 (The GFP-Puro is from a PGK promoter; the shRN…Available SinceMay 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 5
Plasmid#51764PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 5
UseCRISPR and LentiviralPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 4
Plasmid#51763PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 4
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 3
Plasmid#51762PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 3
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 6
Plasmid#51765PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 6
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbVPE1a/b
Plasmid#223218PurposeExpresses an sgRNA targeting the NbVPE1a/b genes in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbVPE1a/b
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantPromoterArabidopsis U6 promoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-chiRNA
Plasmid#45946PurposePlasmid for expression of chiRNA under the control of the Drosophila snRNA:U6:96Ab promoter.DepositorInsertU6-BbsI-chiRNA
UseCRISPRExpressionInsectPromoterDm-snRNA:U6:96AbAvailable SinceJune 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFH6
Plasmid#86555PurposeSubcloning of any sgRNA via BbsI sites. Note that there is an improved version of this plasmid (Addgene 105866) that results in up to 10x greater efficiencyDepositorInsertU6-26p::sgRNA scaffold
UseCRISPR; SubcloningPromoterArabidopsis U6-26 promoterAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAf-CRISPR-yA
Plasmid#191015PurposeCRISPR vector based on Aspergillus flavus U6 promoter and terminator for targeting the yA gene, which contains AMA1(the HindIII-PstI fragment) and ptrA selection marker.DepositorInsertyA
UseCRISPRPromoterAspergillus flavus U6Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
Circular guide cloning vector
Plasmid#180184PurposeCloning vector for expressing circular RNA from a U6 promoterDepositorTypeEmpty backboneUseAAVExpressionMammalianPromoterU6Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only