We narrowed to 5,408 results for: U6
-
Plasmid#118645PurposeTransient transfection; Expressed Control (CUG repeat) CasRx gRNA; Gateway DonorDepositorInsertgCasRx-CUG
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
p2T-CAG-MCS-P2A-GFP-PuroR
Plasmid#107186PurposeBase plasmid for cloning gene duplication alleles with eGFP reporter.DepositorTypeEmpty backboneAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
p2T-CAG-SpCas9-BlastR
Plasmid#107190PurposeConfers constitutive expression of SpCas9DepositorInsertSpCas9 (NEWENTRY )
UseCRISPRTags3xFLAGExpressionBacterial and MammalianPromoterChicken ß-actinAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
px330 Rosa26 Gu1 (LH416)
Plasmid#99629PurposePlasmid used to target the wildtype Rosa26 allele with Cas9DepositorInsertCas9
UseCRISPRAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-GFP-SFPQ
Plasmid#97084PurposeEncodes an sgRNA that creates a DSB at the promoter of human SFPQ gene.DepositorInsertsgRNA GFP-SFPQ
UseCRISPRPromoterU6Available SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
BRCA2 A12.2 gRNA
Plasmid#90551Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA2DepositorInsertBRCA2 (Guide Designation A12.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
VE-cad KI gRNA2
Plasmid#92311PurposeCRISPR-GFP-gRNA for cutting VEcadDepositorAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTE4254
Plasmid#89050PurposeExpresses St chimeric gRNA and human codon-optimized StCas9DepositorInsertsSt chimeric gRNA
hStCas9
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCMV and human U6Available SinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMA-SpCas9-g10
Plasmid#80793PurposeBsaI-based cloning of SpCas9 gRNA guide sequence, position 10/20/30 in the arrayDepositorInsertCRISPR gRNA expression cassette (for SpCas9)
UseCRISPRTagsnaExpressionMammalianPromoterU6Available SinceSept. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMA-SpCas9-g9
Plasmid#80792PurposeBsaI-based cloning of SpCas9 gRNA guide sequence, position 9/19/29 in the arrayDepositorInsertCRISPR gRNA expression cassette (for SpCas9)
UseCRISPRTagsnaExpressionMammalianPromoterU6Available SinceSept. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMA-SpCas9-g8
Plasmid#80791PurposeBsaI-based cloning of SpCas9 gRNA guide sequence, position 8/18/28 in the arrayDepositorInsertCRISPR gRNA expression cassette (for SpCas9)
UseCRISPRTagsnaExpressionMammalianPromoterU6Available SinceSept. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-MGAT1-KO
Plasmid#80009PurposegRNA to knock out expression of MGAT1 gene. The product of this gene is essential for synthesis of complex and hybrid N-Glycans.DepositorInsertMGAT1 (MGAT1 Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-TNFa-shRNA3
Plasmid#72598PurposeExpress shRNA against mouse TNF-alphaDepositorAvailable SinceJan. 11, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
sgRNA1_ASCL1
Plasmid#64129PurposePhotoactivatable transcription system. Lentiviral expression of ASCL1 sgRNA1. Also contains a CMV-puro-t2A-mCherry expression cassette.DepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC25
Plasmid#62328PurposesgRNA + 1x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-TUBA1B
Plasmid#207763PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of TUBA1B for knock-in.DepositorInsertsgRNA Targeting N-terminus of TUBA1B (TUBA1B Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE-dCas9-VPR-pA-3xsgRNA-EF1a-Tet.O-T2A-PuroR-polyA
Plasmid#166693PurposeExpress dCas9-VPR in a doxycyclin-inducable system and 3 sgRNAs targeting the murine Cnga1 promoter. Can be stably integrated into the genome via the PiggyBac Transposon system.DepositorInsertsdCas9-VPR
3x Cnga1 promoter-targeting sgRNAs
UseCRISPRExpressionMammalianPromoterTRE and U6Available SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
vHB16
Plasmid#193455PurposeExpression of GFP-Cas9-NLS and gRNA in A. castellaniiDepositorInserttRNA-gRNA
UseCRISPRPromoterU6Available SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR_zeo_sgNT135
Plasmid#183181PurposepLentiCRISPR that is selectable with zeocin with a non-targeting sgRNADepositorInsertNT135
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAT100
Plasmid#180512PurposePlasmid expressing mammalian codon optimized engineered chimeric PlmCasX-R1, sgRNAv2 scaffold, and restriction sites to clone in new spacersDepositorInsertsCasX sgRNAv2
PlmCasX with DpbCasX R1 loop
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianPromoterCAG and U6Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only