We narrowed to 10,133 results for: gnas
-
Plasmid#133981Purposemammalian expression vector of Flag tagged RNF168 where both motifs interacting with ubiquitin have been deletedDepositorInsertRNF168 (RNF168 Human)
TagsFlagExpressionMammalianMutationdeletion of MIU1 and MIU2PromoterCMVAvailable SinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-OptoTGFBRs
Plasmid#118942PurposeMammalian expression plasmid of OptoTGFBRs (optogenetically-activated TGFb receptors)DepositorTagstdTomatoExpressionMammalianPromoterCMVAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-RNF168 delta MIU2
Plasmid#133979Purposemammalian expression vector of Flag tagged RNF168 where the second motif interacting with ubiquitin (MIU) has been deletedDepositorAvailable SinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
EGFPC2-Gephyrin P1
Plasmid#68815Purposeexpression of fluorescent tagged Geph in mammalian cellsDepositorInsertGephyrin (Gphn Rat)
TagsEGFPExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyri…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER20-α-Syn
Plasmid#92200PurposeRetroviral overexpression vector (doxycycline-inducible) for α-SynDepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL403
Plasmid#119953PurposeExpresses GPPS and LimS, for the production of GPP and (S)-limonene, in Escherichia coli.DepositorInsertsgpps
limS
ExpressionBacterialMutationN-terminal truncation of 56 amino acid residues (…Available SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgAAVS1
Plasmid#85802PurposeCas9/CRISPR vector for cut at human AAVS1 gene intron1DepositorInsertPPP1R12C (PPP1R12C Human)
ExpressionMammalianAvailable SinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ALK3 K261R
Plasmid#80875Purposemammalian expression of ALK3 K261RDepositorInsertALK3 (BMPR1A Human)
TagsHAExpressionMammalianMutationK261R (Kinase inactive)PromoterCMVAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pPGK-T7/2-CD44v2-10 (fl)
Plasmid#137824Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v2-10 (fl) (CD44 Human)
TagsGFPExpressionMammalianMutationfull length and mutations A282T, T483A, N535D, S5…PromoterPGKAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L
Plasmid#224381PurposeLenti plasmid for generating GNB1L expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
ExpressionBacterial and MammalianAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-hygro-STING R232
Plasmid#102608PurposeRetroviral vector to expression STING R232DepositorAvailable SinceJan. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRC3 CTF-FLAG
Plasmid#217686PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertCELSR3 (CELSR3 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-2516Available SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-GSX2
Plasmid#96964PurposeDox-inducible expression of Gsx2 in mammalian cellsDepositorInsertGSX2 (Gsx2 Mouse)
ExpressionMammalianAvailable SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
GLI1_pLENTI-CAG-IRES-GFP
Plasmid#176992PurposeMammalian lentiviral expression vector encoding GLI1DepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR2
Plasmid#167001PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR1
Plasmid#167000PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P2-MDM2 (17-125)
Plasmid#62063PurposeExpression of human MDM2 (17-125) in e. coliDepositorInsertMDM2 (MDM2 Human)
TagsGSTExpressionBacterialMutationcontains residues 17-125PromotertacAvailable SinceFeb. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR3
Plasmid#167002PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-Flex/3'USS-hM4D/2A/GFP(ATG mut)
Plasmid#197892PurposeCan be used to generate AAV virus that will express hM4D/2A/GFP in the presence of Cre and the leakage expression is significantly reduced without CreDepositorInserthM4D/2A/GFP
UseAAVMutationN/APromoterEF1aAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR10
Plasmid#167003PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
DOP1B_pcDNA6.2/EmGFP-Bsd
Plasmid#176979PurposeMammalian expression vector encoding DOP1B and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ALK6 wt
Plasmid#80882Purposemammalian expression of ALK6 WTDepositorAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
IFNAR2_pcDNA6.2/EmGFP-Bsd
Plasmid#176938PurposeMammalian expression vector encoding IFNAR2 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRC3 CTFdeltaTA-FLAG
Plasmid#217719PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertCELSR3 (CELSR3 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-2522Available SinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEAT8-137 M1V
Plasmid#173807PurposeExpression and purification of mature (no signal sequence) human alpha1-antitrypsin wildtype variant M1V (UniProt P01009) from E. coli BL21(DE3) cellsDepositorInsertSERPiNA1 (SERPINA1 Human)
ExpressionBacterialMutationE1M Otherwise this plasmid encodes the most commo…PromoterT7Available SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
BcLOV4 fusion tools screening plasmid #2
Plasmid#174512PurposeCloning plasmid for creating BcLOV4 optogenetic tool fusions. Expresses [BamHI]-mCherry-[XhoI]-GGGSx2-BcLOV4-[EcoRI]-GGGS-3xFLAG-STOP in a pcDNA3.1 backbone.DepositorInsertplasmid B [BamHI]-mCherry-[XhoI]-GGGSx2-BcLOV4-[EcoRI]-GGGS-3xFLAG-STOP
Tags3xFLAG and mCherryExpressionMammalianPromoterCMVAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
CIBN-GFP-Sec61B
Plasmid#104177PurposeExpresses fusion of CIB1 (1-170) with GFP and Sec61BDepositorAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPBneo-CIBN-lin-p53CT(98-393)-6KQ-mNeonGreen-NLSx3
Plasmid#241848PurposeExpresses an improved localizer of Opto-p53 in mammalian cells.DepositorInsertp53 (TP53 Human)
TagsCIBN and mNeonGreenExpressionMammalianMutationp53 C-terminus (97-393 aa) containing six acetyla…PromoterCAGGS promoterAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
TUBG1_pLX307
Plasmid#98376PurposeLentiviral expression of TUBG1DepositorAvailable SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6-N-3XFLAG-Gp78
Plasmid#123590DepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hARdelta538-614
Plasmid#89107Purposemammalian expression of human androgen receptor with deletion of amino acids 538-614, deletion of AR DNA binding domainDepositorAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
JpExpress404 PTEN-LONG
Plasmid#49417PurposeBacterial Expression VectorDepositorAvailable SinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRC1 CTF-FLAG
Plasmid#217684PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertCELSR1 (CELSR1 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-2447Available SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
CMV-10-3xFLAG-LGP2-K651E
Plasmid#58685PurposeExpresses LGP2 with a mutation in the CTD (K651E) in mammalian cellsDepositorInsertLGP2-K651E (DHX58 Human)
Tags3x FLAGExpressionMammalianMutationmutation to CTD, K651EPromoterCMVAvailable SinceJuly 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
ITGB2_pcDNA6.2/EmGFP-Bsd
Plasmid#176983PurposeMammalian expression vector encoding ITGB2 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX303-PCDH7-a
Plasmid#108538PurposeExpresses human PCDH7 transcript variant a in mammalian cellsDepositorAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GfaABC1D-cOpn5-T2A-EGFP
Plasmid#237859PurposeThe transfer plasmid for packaging AAV expressing chicken OPN5 was constructed by inserting the OPN5 coding sequence into the multiple cloning site under the control of GfaABC1D promoterDepositorAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-N-HA-Gp78
Plasmid#123591DepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHR FGFR1-CD3ε-FusionRed
Plasmid#188632PurposeHuman FGFR1 labeled with CD3ε ITAMs for monitoring with CD3ε/ZtSH2 pYtag biosensorDepositorInsertFGFR1 (FGFR1 Synthetic, Human)
UseLentiviralTagsCD3ε-FusionRedExpressionMammalianPromoterSFFVAvailable SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
PH-Btk-mRuby2
Plasmid#124657PurposePI(3,4,5)P3 probe. PH domain of BTK fused with mRuby2DepositorInsertBTK (BTK Human)
TagsmRuby2ExpressionMammalianMutationcontains only the PH domain of Bruton tyrosine ki…Available SinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRG6 CTFdeltaTA-FLAG
Plasmid#217737PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGR6 (ADGRG6 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-846Available SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRL2 CTFdeltaTA-FLAG
Plasmid#217740PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRL2 (ADGRL2 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-830Available SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3 1 kb prom. + Enhancer CD274
Plasmid#107005PurposeModified Luciferase expression vectorDepositorInsertCD274 (CD274 Human)
UseLuciferaseExpressionMammalianMutationN.B. There are two published SNPs in this region …Available SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
LIMD1_pLX307
Plasmid#98349PurposeLentiviral expression of LIMD1DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-fDIO-OFF-ArgiNLS-oScarlet
Plasmid#220606PurposeFlp-independent expression of a single-cell discriminating version of oScarlet fluorescent protein. Flp activity can turn off expression.DepositorInsertoScarlet
UseAAVTagsArgiNLSExpressionMammalianPromoterCAGAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cry2 mCherry GRK2 ct in pcDNA3.1
Plasmid#64212PurposemCherry fused between Cry2 and GRK2ct to study cell migrationDepositorTagsmcherryExpressionMammalianPromoterCMV and cmvAvailable SinceJune 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL3 3'UTR reporter WT 1.3 kb CD274 Hs 3'UTR Final
Plasmid#107009PurposeModified Luciferase expression vectorDepositorAvailable SinceMarch 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P2-p53 (1-90) (72R)
Plasmid#62081PurposeExpression of human p53 (TAD residues 1-90) (72R) in e. coliDepositorInsertp53 (TP53 Human)
TagsGSTExpressionBacterialMutationContains TAD/PP residues 1-90, 72RPromotertacAvailable SinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only