-
Plasmid#227302PurposeDonor template for mStayGold insertion into the C-terminus of the VIM locus. For intermediate filament visualization. To be co-transfected with sgRNA plasmid px330-PITCh-VIM (Addgene #227301)DepositorInsertVIM Homology Arms flanking a mStayGold Tag (VIM Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
single polypeptide FPX biosensor for calcium ion
Plasmid#60887PurposeFPX biosensorDepositorInsertsingle polypeptide FPX biosensor for calcium ion
UseTagsHindIII siteExpressionMammalianMutationPromoterCMVAvailable sinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
TC1316
Plasmid#164883PurposeCMV-bpNLS-dCas13d-bpNLS-ADARdd-mCherry, ADARdd embeded in loop3DepositorInsertdcas13d-ADARdd
UseTagsExpressionMammalianMutationdCas13d L560-G586 deletedPromoterCMV, T7Available sinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV_dCas9-ZIM3-KRAB_sgTAOK2i_#2
Plasmid#172984PurposeCRISPRi for TAOK2DepositorInsertsgTAOK2i (TAOK2 Human)
UseCRISPR and LentiviralTags3xFLAGExpressionMutationPromoterAvailable sinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H74
Plasmid#170338PurposemTDel_EPACdDEPCD_cp173Ven(ST)_Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmTDel_EPACdDEPCD_cp173Ven(ST)_Ven(ST) (RAPGEF3 Human)
UseTagsExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable sinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-LivePAR(Y107A)-Hygro
Plasmid#176073PurposeEGFP fused to the C-terminus of a WWE domain containing the mutation Tyr107Ala & a hygromycin resistance cassetteDepositorInsertLivePAR (Y107A)
UseLentiviralTagsEGFPExpressionMammalianMutationPoint mutation to convert Try107 to AlaPromoterEF1AAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HLA-cMyc-EcopT1R1
Plasmid#113962Purposemammalian expression plasmid for c-myc-tagged E. coli codon-optimized human T1R1 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R1 (TAS1R1 Human)
UseTagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationtruncate N-terminal 24 residuesPromoterAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mNeon-Puro-TOMM20
Plasmid#207790PurposeDonor template for mNeon-2A-Puro insertion into the C-terminus of the TOMM20 locus. For mitochondria visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TOMM20 (Addgene #207789)DepositorInsertTOMM20 Homology Arms flanking a mNeon-Puro Cassette (TOMM20 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-ACTB
Plasmid#207748PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of ACTB for knock-in.DepositorInsertsgRNA Targeting N-terminus of ACTB (ACTB Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H188
Plasmid#170349PurposemT2Del_EPACdDEPCD_tdcp173Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_tdcp173Ven(ST) (RAPGEF3 Human)
UseTagsExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable sinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-PEmax
Plasmid#206883PurposeExpresses FLAG-tagged PEmax fused to Gag through a linker sequenceDepositorInsertPEmax
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterCMVAvailable sinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
A2_uSFFV
Plasmid#153415PurposeExpresses HLA-A*02:01 MHCI gene by the UCOE-SFFV promoterDepositorInsertA*02:01-P2A-human beta2 microglobulin (B2M Human)
UseLentiviralTagsExpressionMammalianMutationPromoterSFFVAvailable sinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-B-GRAM-H-NeoR
Plasmid#211709PurposeLentiviral expression of a dimerization-dependent fluorescent protein (ddFP) subunit (B) fused with the GRAM domain of GRAMD1b carrying a G187L mutation (B-GRAM-H)DepositorInsertB-tagged GRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
UseLentiviralTagsddFP-B3ExpressionMammalianMutationChanged Glycine 187 to LeucinePromoterCMVAvailable sinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
JG1211: CAG-human dLbCpf1(D832A)-NLS-3xHA-VPR
Plasmid#104567PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to VPR activatorDepositorInserthuman codon optimized ‘dead’ Cpf1 fused to HSV VPR activation domain
UseCRISPRTagsNLS-3xHA-VPRExpressionMammalianMutationD832APromoterCAGAvailable sinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPtGE34
Plasmid#107932PurposeExpresses Cas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
UseCRISPR and Synthetic Biology; Episomal vector for…TagsExpressionMutationPromoterAvailable sinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiBE3-SpRY-Blast
Plasmid#199303PurposeExpresses SpRY Cas9 nickase cytosine base editor FNLS-BE3 and blasticidin resistanceDepositorInsertFNLS-BE3-SpRY
UseCRISPR and LentiviralTags2A tagExpressionMammalianMutationPromoterEFSAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP773_pLenti-6xHRBKET-sgRNA
Plasmid#211766PurposeMultiplexed gRNA plasmid targeting six different gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1), with mCherry selectionDepositorInsertgRNAs against six different human gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1)
UseLentiviralTagsExpressionMutationPromoterpCMV and U6Available sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
TOM20*-SBP-GFP
Plasmid#120173PurposeExpresses a chimera of the mitochondria-targeting signal of TOM20, SBP tag and GFP (fluorescent tag)DepositorInsertMitochondrial import receptor subunit TOM20 homolog (TOMM20 Human)
UseTagsSBP and eGFPExpressionMammalianMutationTruncated TOM20: 1-30 aaPromoterCMVAvailable sinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hA3A-eBE-Y130F
Plasmid#113423PurposeExpresses hA3A-eBE-Y130F in mammalian cellsDepositorInserthA3A-eBE-Y130F (APOBEC3A S. pyogenes and Bacteriophage PBS2, Human)
UseCRISPRTagsExpressionMammalianMutationhAPOBEC3A_Y130FPromoterCMVAvailable sinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 ECD-MHC
Plasmid#113957Purposemammalian expression plasmid for FLAG-tagged human T1R2 ECD with signal peptide of influenza hemagglutinin fused to a canonical transmembrane domain from MHC class IDepositorInsertT1R2 (TAS1R2 Human)
UseTagsFLAG, Signal/leader sequence from influenza hemag…ExpressionMammalianMutationresidues 22-568 fused to a transmembrane tetherPromotercmvAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1 Clover-LMNA Donor
Plasmid#122508PurposeHomology repair template for in frame (first exon) clover knock-in of human LMNA geneDepositorInsertHomology Repair Template for Human LMNA (N-Terminal Clover Tag) (LMNA Human)
UseHomology repair template plasmid (donor plasmid)TagsCloverExpressionMutationPromoterAvailable sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dCas9-D3A
Plasmid#78256PurposeExpresses dead Cas9 (dCas9) fused to DNMT3A catalytic domain (CD) under the control of the CMV promoterDepositorInsertDNMT3A CD aa 598-912 (DNMT3A Human)
UseCRISPRTagsFlag epitope tagExpressionMammalianMutationPromoterpCMVAvailable sinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gαi3-LgB91
Plasmid#134359PurposeNanoluc complementation assay. Expression of Gαi3 protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 91 and 92 of Gαi3. Addition of the HA epitope at N terminus of Gαi3.DepositorInsertGαi3-LgB91 (GNAI3 Human)
UseTagsHAExpressionBacterial and MammalianMutationPromoterT7Available sinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-P2A-Puro
Plasmid#110837PurposeLentiviral vector for expression of Cas9 in mammalian cells (codon optimized)DepositorInsertCas9
UseLentiviralTagsExpressionMutationWTPromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-LivePARBackbone
Plasmid#176526PurposeExpression vector with a BamHI site in-frame with a Gly-Ser linker fused to EGFP; serves as the backbone for PAR binding domain incorporation for LivePARDepositorTypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianMutationPromoterEF1AAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL7 lenti-dcas9-3xflag-blast
Plasmid#112133Purposelenti vector encoding dcas9-3xflag with T2A Blastcidin resistance marker (EF1a-NLS-dCas9-3Xflag-T2A-Blast-WPRE)DepositorInsertdCas9(D10A, N863A)-T2A-Blast
UseCRISPR and LentiviralTagsExpressionMammalianMutationD10A and N863A mutants in Cas9PromoterEF1aAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-TOMM20
Plasmid#227307PurposeDonor template for mStayGold insertion into the C-terminus of the TOMM20 locus. For mitochondria visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TOMM20 (Addgene #207789)DepositorInsertTOMM20 Homology Arms flanking a mStayGold Tag (TOMM20 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_nV5-AMOTL2
Plasmid#172999Purposeconstitutive expression of V5-tagged AMOTL2DepositorInsertV5-AMOTL2 (AMOTL2 Human)
UseTagsV5ExpressionMammalianMutationPromoterAvailable sinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-MTS-G3635A-L17-FZY2-S100N-T26I&T77I-UGI-Puro
Plasmid#209645PurposeTo install m.G3635 mutation on mtDNADepositorInsertL17-FZY2-S100N-T26I&T77I
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNICKclos2.0
Plasmid#73228PurposeGenome editing for gene xylR (cbei-2385) in clostridium beijerinckii NCIMB 8052DepositorInsertsCas9 nickase
sgRNA to xylR
UseE.coli - clostridium shuttle vectorTagsExpressionMutationD10APromoterPj23119 and PthlAvailable sinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
SacI ML GFP Strand 11 Short
Plasmid#164121PurposeDetect the short Mitochondria-Endoplasmic reticulum contact along with the OMMGFP1-10DepositorInsertSacI ML GFP Strand 11 Short
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAaePUb::Cas9-2A-Neo
Plasmid#176680PurposeExpression of Drosophila codon optimized spCas9 under Ae. aegypti Polyubiquitin promoter (AAEL003888)DepositorInsertspCas9; NeoR (aminoglycoside phosphotransferase from Tn5)
UseCrisprTagsExpressionInsectMutationDrosophila codon optimizedPromoterAe. aegypti poly-ubiquitin (AAEL003888)Available sinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVC-DNAJB6b
Plasmid#175065Purposeexpresses mVenus and mCherry tagged DNAJB6b in mammalian cellsDepositorInsertDNAJB6b (DNAJB6 Human)
UseTagsV5 and mVenus + mCherryExpressionMammalianMutationmVenus: C-Terminal deletion of 11 aa (GITLGMDELYK…PromoterCMV PromoterAvailable sinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-PEmaxRH
Plasmid#206884PurposeExpresses FLAG-tagged PEmax (lacking the RNAseH domain) fused to Gag through a linker sequenceDepositorInsertPEMax Delta RNAseH
UseTagsFLAGExpressionMutationPromoterCMVAvailable sinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
enIscB
Plasmid#205410PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_npNLS_polyA_pU6__RNA*_pCMV_mCherry
UseTagsExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable sinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.D2-NP
Plasmid#134366PurposeNanoluc complementation assay. Expression of dopamine receptor D2 fused at C terminus with Natural peptide (NP) of NanoLuc. Addition of the signal sequence and Flag epitope at N terminus of D2.DepositorInsertD2-NP (DRD2 Human)
UseTagsFlag, natural peptide of nanoluciferase, and sign…ExpressionBacterial and MammalianMutationPromoterT7Available sinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC
Plasmid#62806PurposeTo express genes at high levels in neuronal cells. This UbC promoter is more active in neurons than the promoter in CMV-based vectors.DepositorTypeEmpty backboneUseAAV; EucaryoticTagsExpressionMammalianMutationPromoterhUbCAvailable sinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJEP316-pAAV-U6SaCas9gRNA(SapI)-pA Empty Cassette
Plasmid#113693PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. SapI can be used to clone in gRNAs.DepositorInsertSaCas9 gRNA Cassete
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
YET1000: CAG-human dLbCpf1(D832A)-NLS-3xHA-3xFLAG-DmrA(X4)
Plasmid#104571PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to four DmrA domainsDepositorInserthuman codon optimized ‘dead’ Cpf1 fused to four DmrA domains
UseCRISPRTagsNLS-3xHA-3xFLAG-4xDmrAExpressionMammalianMutationD832APromoterCAGAvailable sinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gαi2-LgB91
Plasmid#134358PurposeNanoluc complementation assay. Expression of Gαi2 protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 91 and 92 of Gαi2. Addition of the HA epitope at N terminus of Gαi2.DepositorInsertGαi2-LgB91 (GNAI2 Human)
UseTagsHAExpressionBacterial and MammalianMutationPromoterT7Available sinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-3xHA-LMNB1
Plasmid#207778PurposeDonor template for Blast-2A-3xHA insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xHA Cassette (LMNB1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Puro-mNeon-ACTB
Plasmid#207752PurposeDonor template for Puro-2A-mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Puro-mNeon Cassette (ACTB Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-sTagRFP-TUBA1B
Plasmid#207769PurposeDonor template for Puro-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1_nV5-AMOT (p130)
Plasmid#172997Purposeconstitutive expression of V5-tagged AMOT (p130)DepositorInsertV5-AMOT (p130) (AMOT Human)
UseTagsV5ExpressionMammalianMutationPromoterAvailable sinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
SUV[SET]-dCas9
Plasmid#100088PurposeCatalytic domain [SET] of human SUVAR39H1 fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertSUVAR39H1 (SUV39H1 Human)
UseCRISPRTags3XFLag-NLS-SUV[SET]-dCas9-NLSExpressionMammalianMutationdeleted aa 1-76PromoterCMVAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CETN2
Plasmid#227292PurposeDonor template for mStayGold insertion into the N-terminus of the CETN2 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CETN2 (Addgene #227291)DepositorInsertCETN2 Homology Arms flanking a mStayGold Tag (CETN2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-BS-AtMIR390a-B/c
Plasmid#199560PurposePlant expression vector (2x35S) for direct cloning of amiRNAs into Arabidopsis thaliana MIR390a precursor including only the basal stemDepositorInsertBasal stem of Arabidopsis MIR390a precursor including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites (MIR390a Mustard Weed)
UseRNAiTagsExpressionMutationPromoter2x35SAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BG505.SOSIP-gp160-QES.i05.c06
Plasmid#123276PurposeMammalian expression plasmid for Env from the BG505 HIV-1 isolate (containing SOSIP mutations); QES mutant for enhanced presentation of quaternary epitopesDepositorInsertHIV-1 (BG505) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; SOSIP mutations; …PromoterCMVAvailable sinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
HT103_FCMV_QuasAr6a_Citrine
Plasmid#178822PurposeExpresses an archaerhodopsin-derived genetically encoded voltage indicator QuasAr6a carrying a Citrine expression tagDepositorInsertQuasAr6a_Citrine
UseLentiviralTagscitrineExpressionMammalianMutationPromoterCMVAvailable sinceMarch 25, 2022AvailabilityAcademic Institutions and Nonprofits only