We narrowed to 10,180 results for: yeast
-
Plasmid#229525PurposeCarries OsTIR1-t2a-mNG-AID*, used to insert TIR1 expressing construct into the C. neoformans genome.DepositorInsertOsTIR1
UseCRISPRTagst2a-mNeonGreen-AID*ExpressionBacterial and YeastMutationF74GPromoterTEF1Available SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBHM2647
Plasmid#229989PurposeCarries OsTIR1-t2a-mNG-mIAA7, used to insert TIR1 expressing construct into the C. neoformans genome.DepositorInsertOsTIR1
Tagst2a-mNeonGreen-mIAA7_optExpressionBacterial and YeastMutationF74GAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBHM2648
Plasmid#229990PurposeCarries OsTIR1-t2a-mNG-mIAA7, used to insert TIR1 expressing construct into the C. neoformans genome.DepositorInsertOsTIR1
Tagst2a-mNeonGreen-mIAA7_optExpressionBacterial and YeastMutationF74GAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBHM2649
Plasmid#229991PurposeCarries OsTIR1-t2a-mNG-mIAA7, used to insert TIR1 expressing construct into the C. neoformans genome.DepositorInsertOsTIR1
Tagst2a-mNeonGreen-mIAA7_optExpressionBacterial and YeastMutationF74GAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
LHP2691 - pET30-Ub-K63A
Plasmid#32179DepositorTagsHISExpressionBacterialMutationK63APromoterT7Available SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
LHP2690 - pET30-Ub-K48A
Plasmid#32178DepositorTagsHISExpressionBacterialMutationK48APromoterT7Available SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
STK25
Plasmid#39075PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAG426-GAL-TAF15
Plasmid#181713PurposeGalactose inducible expression of TAF15DepositorInsertTAF15 (TAF15 Human)
ExpressionYeastAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-24a-STE2
Plasmid#133430PurposeYeast STE2 coding sequence in vector for in vitro transcription and protein synthesis, with T7 promoter.DepositorInsertSTE2 (STE2 Budding Yeast)
ExpressionBacterialMutationBoth native Cys (C59S/C252A) have been mutated. S…Available SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXP420 v2 (repaired Amp promoter)
Plasmid#86920PurposeShuttle vector to facilitate gene expression for metabolic engineering in S. cerevisiae. Contains TEF1 promoter and CYC1 terminator for insertion of gene of interest. Contains HIS3 selection marker.DepositorTypeEmpty backboneUseCre/LoxExpressionYeastPromoterTEF1Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJK369
Plasmid#73594PurposeEncodes Crepis alpina delta-12 fatty acid acetylenase (vFAD2) with C-terminal FLAG epitopeDepositorInsertdelta-12 fatty acid acetylenase
TagsFLAG tagExpressionYeastPromoterGAL10Available SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
YIplac211-Kar2-moxGFP2-HDEL
Plasmid#218970PurposeGene replacement plasmid to label S. cerevisiae Kar2 with moxGFP2DepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG426-GAL-Prepro-3x-Adan
Plasmid#181733PurposeGalactose inducible expression of Prepro-3x-AdanDepositorInsertPrepro-3x-Adan
ExpressionYeastAvailable SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
HCP1
Plasmid#166103PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombination.DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJK138
Plasmid#73314PurposePas2p peroxisomal membrane targeting sequenceDepositorInsertPas2p (peroxisomal membrane targeting region)
TagsHis6 and c-mycExpressionYeastMutationencodes residues 1-42PromoterAOX1Available SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
brr2-R1107M pRS313
Plasmid#111417Purposebrr2-R1107M (endogenous promoter)DepositorInsertBRR2
ExpressionYeastMutationR1107M aa mutation (note, not an RP allele)AvailabilityAcademic Institutions and Nonprofits only -
pAG303-Gal-PR50
Plasmid#84905Purposeinduce expression of dipeptide repeat PR in yeastDepositorAvailable SinceNov. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNK5785
Plasmid#219753PurposepGAP-like vector encoding mutant of Neonothopanus nambi luciferase nnLuz_v4 under control of GAP promoter, for yeast expressionDepositorInsertpGAP - nnLuz_v4 - tAOX
UseLuciferaseExpressionYeastAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUG34-NES-EGFP-cPHx3
Plasmid#183669PurposePtdIns(3,4)P2 biosensor for expression in yeastDepositorInsertPLEKHA1 (PLEKHA1 Frog, Human)
TagsX. laevis map2k1.L(32-44)-EGFPExpressionYeastMutationAmino acids 169-329 (tandem trimer)PromoterMET25Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYeDP60-hATP13A2-WT
Plasmid#171377PurposeA modified pYEDP60 plasmid containing a yeast codon-optimized version of human ATP13A2 variant 2, followed by a thrombin cleavage site and a C-terminal BAD tag. DOI: 10.21769/BioProtoc.3888DepositorInserthuman ATP13A2 variant 2 wild-type
TagsBAD tagExpressionYeastPromoterURA3Available SinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAG303-Gal-PA50
Plasmid#84906Purposeinduce expression of dipeptide repeat PA in yeastDepositorAvailable SinceApril 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAG303-Gal-GA50
Plasmid#84907Purposeinduce expression of dipeptide repeat GA in yeastDepositorAvailable SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMB.BIG1a.PRC2
Plasmid#234581PurposeExpression of EZH2, MBP-SUZ12, EED, RBBP4DepositorAvailable SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS_128
Plasmid#160651PurposeExpresses Human APOE3 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoterDepositorInsertApolipoprotein E e3 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione3 allelePromoterpZ estradiol inducible promoterAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG303-Gal-GR100
Plasmid#84908Purposeinduce expression of dipeptide repeat GR in yeastDepositorAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG416-Gal-PR50
Plasmid#84901Purposeinduce expression of dipeptide repeat PR in yeastDepositorAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYX233-b2-DHFR
Plasmid#163759PurposeGal-inducible yeast expression of the mitochondrial "clogger" protein b2(167)-DHFRDepositorInsertb2-DHFR (Dhfr Mouse, Budding Yeast)
ExpressionYeastMutationAmino acids 1-167 of S.c. Cytochrome b2 (Cyb2) fu…PromoterGAL1Available SinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAG416-Gal-PA50
Plasmid#84902Purposeinduce expression of dipeptide repeat PA in yeastDepositorAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG416-Gal-GA50
Plasmid#84903Purposeinduce expression of dipeptide repeat GA in yeastDepositorAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGS_129
Plasmid#160652PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterpZ estradiol inducible promoterAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNK5712
Plasmid#219752PurposepGAP-like vector encoding mutant of Neonothopanus nambi hispidin-3-hydroxylase nnH3H_v2 under control of GAP promoter, for yeast expressionDepositorInsertpGAP - nnH3H_v2 - tAOX
ExpressionYeastAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK5867
Plasmid#219751PurposepGAP-like vector encoding hispidin-synthase from Mycena citricolor under control of GAP promoter, for yeast expressionDepositorInsertpGAP - mcitHispS - tAOX
ExpressionYeastAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK1508
Plasmid#219750PurposepGAP-like vector encoding Aspergillus nidulans 4'-phosphopantetheinyl transferase NpgA under control of GAP promoter, for yeast expressionDepositorInsertpGAP - npgA - tAOX
ExpressionYeastAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
DHC1-AID-Clover donor (Hygro)
Plasmid#158622PurposeDonor plasmid for tagging DHC1 with AID-CloverDepositorInsertDHC1 (DYNC1H1 Human)
UseCRISPR; Tagging donorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
SSH-pSUMO-α-COPI-WD40
Plasmid#208341PurposeBacterial expression plasmid for Schizosaccharomyces pombe α-COPI-WD40DepositorInsertN-terminal WD40 domain of yeast α-COPI (1-327) with substitutions (Leu181Lys, Leu185Lys, Ile192Lys, Leu196Lys and Phe197Lys)
TagsHis-tag, SUMO-tag, and Strep-tagExpressionBacterialMutationLeu181Lys, Leu185Lys, Ile192Lys, Leu196Lys and Ph…Available SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
DHC1-AID-Clover donor (Neo)
Plasmid#158621PurposeDonor plasmid for tagging DHC1 with AID-CloverDepositorInsertDHC1 (DYNC1H1 Human)
UseCRISPR; Tagging donorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
3322_pETcon_SARS2_Omicron-BA2
Plasmid#184409Purposeyeast surface display of the SARS-CoV-2 Omicron BA.2 variant RBDDepositorInsertSARS-CoV-2 Omicron BA.2 Spike receptor binding domain (RBD) (S SARS-CoV-2 virus)
TagsHA and c-MycExpressionYeastMutationG339D+S371F+S373P+S375F+T376A+D405N+R408S+K417N+N…Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28-Kss1
Plasmid#52682PurposeExpression of Kss1 in bacteriaDepositorAvailable SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-3x-uC-ccdB-6stop
Plasmid#203514PurposeGateway-compatible destination vector for yeast expression with GAL1 promoter (3x GAL4 binding sites)/upstream ORF/6stop mutation/URA3 markerDepositorTypeEmpty backboneExpressionYeastAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-1x-ccdB-6stop
Plasmid#203519PurposeGateway-compatible destination vector for yeast expression with GAL1 promoter (1x GAL4 binding sites)/6stop mutation/URA3 markerDepositorTypeEmpty backboneExpressionYeastAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-2x-uA-ccdB-6stop
Plasmid#203517PurposeGateway-compatible destination vector for yeast expression with GAL1 promoter (2x GAL4 binding sites)/upstream ORF/6stop mutation/URA3 markerDepositorTypeEmpty backboneExpressionYeastAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
3294_pETcon-SARS2-RBD_Omicron-BA1
Plasmid#184408Purposeyeast surface display of the SARS-CoV-2 Omicron BA.1 variant RBDDepositorInsertSARS-CoV-2 Omicron BA.1 Spike receptor binding domain (RBD) (S SARS-CoV-2 virus)
TagsHA and c-MycExpressionYeastMutationG339D+S371L+S373P+S375F+K417N+N440K+G446S+S477N+T…Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS416 ATG5-E141D-HA-ATG12-ATG16
Plasmid#166851PurposeExpresses mutant E141D ATG5, HA-ATG12 ATG16 in yeast.DepositorAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBD-PYR1
Plasmid#241278PurposeYeast two hybrid vector expressing BD-PYR1 (wild type)DepositorAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
SSH-pSUMO-β′-COPI-WD40-Lys17Ala
Plasmid#208171PurposeBacterial expression plasmid for Saccharomyces cerevisiae β′-COPI-WD40-Lys17Ala mutant (residues 1-301)DepositorInsertN-terminal domain of yeast β′-COPI-WD40 subunit (1-301) with Lys17Ala substitution
TagsHis-tag, SUMO-tag, and Strep-tagExpressionBacterialMutationLys17Ala substitutionAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL-mGold2s
Plasmid#231761PurposeExpression of mGold2s in yeast cellsDepositorInsertmGold2s
ExpressionYeastMutationmGold2s is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterpTDH(GAP promoter)Available SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNK7185
Plasmid#219765PurposeVector for expression PzPKS2 in yeast (P.pastoris)DepositorInsertPzPKS2
ExpressionYeastPromoterpGAPAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only