We narrowed to 7,237 results for: ALP
-
Plasmid#177528PurposeMammalian Expression Plasmid of anti-Brevican (Rat). Derived from hybridoma N294A/10R.DepositorInsertanti-Brevican (Rattus norvegicus) recombinant mouse monoclonal antibody (Bcan Mouse)
UseTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTM-RBDv2
Plasmid#162785PurposeSARS-CoV-2 S protein receptor binding domain (RBD) expression in mammalian cellsDepositorInsertSARS-CoV-2 S protein receptor binding domain (RBD) (S Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2))
UseTags10xHis, c-myc, and hTPA leaderExpressionMammalianMutationPromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available sinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NES (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PHKA1
Plasmid#23471DepositorInsertPHKA1 (PHKA1 Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-CSNK1A1L
Plasmid#23784DepositorInsertCSNK1A1L (CSNK1A1L Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pT/CAGGS-mVenus-P2A-NRASG12V
Plasmid#236072PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Caggs promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidTagsExpressionMutationG12VPromoterCAGGSAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/UBC-mVenus-P2A-NRASG12V
Plasmid#236074PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Ubc promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidTagsExpressionMutationG12VPromoterUbcAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/CAGGS-NRASG12V/D38A-IRES-mVenus
Plasmid#236077PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Caggs promotor driven expression of mVenus and a double mutant NRAS (NRASG12VD38A).DepositorInsertsUseSleeping beauty transposon plasmidTagsExpressionMutationG12V D38APromoterCAGGSAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/CAGGS-NRASG12V-IRES-mVenus
Plasmid#236076PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Caggs promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidTagsExpressionMutationG12VPromoterCAGGSAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/PGK-mVenus-P2A-NRASG12V
Plasmid#236073PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Pgk promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidTagsExpressionMutationG12VPromoterPGKAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 human HAgHA -plus exon 18a - LONG-Cterm in pcDNA3
Plasmid#198451PurposeN-terminal GFP tagged, exofacial HAgHA tag in Domain II, contains exon 18a- Long form of alternatively spliced C-teminus, in pcDNA3 vectorDepositorInsertCav2.2 (CACNA1B Human)
UseTagsN-terminal GFP, internal double HAExpressionMammalianMutationPromoterCMVAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 human HAgHA -minus exon 18a -LONG-Cterm in pcDNA3
Plasmid#198914PurposeN-terminal GFP tagged, exofacial HAgHA tag in Domain II, does not contain exon 18a - Long form of alternatively spliced C-teminus, in pcDNA3 vectorDepositorInsertCav2.2 (CACNA1B Human)
UseTagsN-terminal GFP, internal double HAExpressionMammalianMutationexon 18a deleted, exon 19 starts 3 nucleotides ea…PromoterCMVAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 human HAgHA-plus exon 18a - Short-Cterm - Arginine -in pcDNA3
Plasmid#198915PurposeN-terminal GFP tagged, exofacial HAgHA tag in Domain II, contains exon 18a, Short form of alternatively spliced C-teminus, SNP rs2278973 variant Arginine, in pcDNA3 vectorDepositorInsertCav2.2 (CACNA1B Human)
UseTagsN-terminal GFP, internal double HAExpressionMammalianMutationsnp rs2278973 ArgininePromoterCMVAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-NRAS(G12D)-Neo
Plasmid#232953PurposeExpresses mutant form of NRASDepositorInsertNRAS(G12D)-Neo (NRAS Human)
UseLentiviralTagsExpressionMutationG12DPromoterAvailable sinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0_shRNAHsCavin1_MmCavin1_EGFP
Plasmid#229689PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of mouse Cavin1 (Cavin1 rescue)DepositorUseLentiviralTagsEGFPExpressionMutationPromoterLTR viral promoterAvailable sinceJan. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgAMPKa2-Cas9-GFP
Plasmid#208050PurposeLentiviral vector expressing Cas9 and an sgRNA targeting AMPKa2DepositorInsertsgPRKAA2 (PRKAA2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-scFVDnmt3AL_bGHpA
Plasmid#177348PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from Synapisin promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterhuman SynapsineAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-scFVDnmt3AL_bGHpA
Plasmid#177354PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterTetracycline-dependent promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-scFVDnmt3A_bGHpA
Plasmid#177355PurposeAAV expression of scFV-fused catalytic domain of Dnmt3a from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsmyc and scFVExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterTetracycline-dependent promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHIV(T9)-DERA-sgresis
Plasmid#222622PurposeLentiviral vector that expresses sgRNA resistant DERA in mammalian cellsDepositorInsertDERA (DERA Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceAug. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
SHIP2-C1
Plasmid#214905Purposeexpression of the truncated variants of the SHIP2 that retains second proline-rich domain and C-terminal sterile alpha motifDepositorInserthuman SHIP2 aa 740-1258 (INPPL1 Human)
UseTagsV5/HisExpressionMammalianMutationdelta 1-739aaPromoterCMVAvailable sinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-837_NY-ESO-1_TCR_tFAS
Plasmid#207500PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInserttFAS, NY-ESO-1_TCR (FAS Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 HA EI,II,III,IVA (E314A, E664A, E1370A, E1658A) pcDNA3
Plasmid#206093PurposeCav2.2 calcium channel with a N-terminal GFP tag, exofacial double HA tag in domain II and mutations in the P loop of Domains I, II, III and IV which abolish trafficking to the cell surfaceDepositorInsertcacna1b (CACNA1B Rabbit)
UseTagsGFPExpressionMammalianMutationE314A, E664A, E1370A, E1658APromoterCMVAvailable sinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cav2.2 HA EI,II,III,IVA (E314A, E664A, E1370A, E1658A) pCAGGS
Plasmid#206098Purposeexpression of rabbit Cav2.2 calcium channel with an exofacial double HA tag in domain II and mutations in the P loop of Domains I, II, III and IV which abolish trafficking to the cell surfaceDepositorInsertcacna1b (CACNA1B Rabbit)
UseTagsExpressionMammalianMutationE314A, E664A, E1370A, E1658APromoterCMV/B-actinAvailable sinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Brevican scFv [N294A/6]
Plasmid#206772PurposeMammalian Expression of Brevican scFV. Derived from hybridoma N294A/6 scFv.DepositorInsertBrevican (Rattus norvegicus) recombinant scFV (Bcan Mouse)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FAS-COMP5AP-AviTag-9xHis
Plasmid#157106PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertFAS (FAS Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-IL1R1-COMP5AP-AviTag-9xHis
Plasmid#157320PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertIL1R1 (IL1R1 Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FASLG-COMP5AP-AviTag-9xHis
Plasmid#157143PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertFASLG (FASLG Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CD8A-COMP5AP-AviTag-9xHis
Plasmid#157118PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertCD8A (CD8A Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-VSIR-COMP5AP-AviTag-9xHis
Plasmid#157120PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertVSIR (C10orf54 Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CTLA4-COMP5AP-AviTag-9xHis
Plasmid#157074PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertCTLA4 (CTLA4 Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCAR-Fc(DAPA)-AviTag-6xHis
Plasmid#156619PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertFCAR (FCAR Human)
UseTagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-ULBP2-Fc(DAPA)-AviTag-6xHis
Plasmid#156596PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertULBP2 (ULBP2 Human)
UseTagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available sinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-Brevican [N294A/6]
Plasmid#190309PurposeMammalian Expression Plasmid of anti-Brevican (Rat). Derived from hybridoma N294A/6.DepositorInsertanti-Brevican (Rattus norvegicus) recombinant Mouse monoclonal antibody (Bcan Mouse)
UseTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CD8A-Fc(DAPA)-AviTag-6xHis
Plasmid#156553PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertCD8A (CD8A Human)
UseTagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available sinceAug. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-719 CTLA4-GFP R70W
Plasmid#186124PurposeCTLA4 gene knockin with mutationDepositorInsertCTLA4 (CTLA4 Human)
UseCRISPRTagsExpressionMutationR70WPromoterAvailable sinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-720 CTLA4-GFP R75W
Plasmid#186125PurposeCTLA4 gene knockin with mutationDepositorInsertCTLA4 (CTLA4 Human)
UseCRISPRTagsExpressionMutationR75WPromoterAvailable sinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTR-337 pUC19-tNGFR-P2A-CTLA4 N
Plasmid#186054PurposeKnockin of truncated NGFR to target geneDepositorInsertCTLA4 (CTLA4 Human)
UseCRISPRTagsExpressionMutationWT with tNGFR sequencePromoterAvailable sinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D
Plasmid#115200PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable sinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293D
Plasmid#115201PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293D (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable sinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D/S293D
Plasmid#115202PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D/S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D/S293D (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable sinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH005_phiC31_neo-core-5xTetO-pEF-H2B-mCitrine-core-pRSV-H2B-mCherry
Plasmid#179433PurposeDual fluorescent reporter construct with double core HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertcoreHS4-TRE-cit-coreHS4-mch (DC)
UseTagsExpressionMammalianMutationPromoterpEF alpha, pRSVAvailable sinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH004_phiC31_neo-HS4-5xTetO-pEF-H2B-mCitrine-HS4-pRSV-H2B-mCherry
Plasmid#179432PurposeDual fluorescent reporter construct with double HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertHS4-TRE-cit-HS4-mch (DH)
UseTagsExpressionMammalianMutationPromoterpEF alpha, pRSVAvailable sinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL008_phiC31_neo-5xTetO-pEF-H2B-mCitrine-5kb,lambda-pRSV-H2B-mCherry
Plasmid#179426PurposeDual fluorescent reporter construct with 5kb lambda spacer, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertTRE-cit-5kb-mch
UseTagsExpressionMammalianMutationPromoterpEF alpha, pRSVAvailable sinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH010_phiC31_neo-5xTetO-pEF-H2B-mCitrine-1.2kb,lambda-pRSV-H2B-mCherry
Plasmid#179427PurposeDual fluorescent reporter construct with 1.2kb lambda spacer, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertTRE-cit-1.2kb-mch
UseTagsExpressionMammalianMutationPromoterpEF alpha, pRSVAvailable sinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVE-FH-Dnd1-IN
Plasmid#70072Purpose2nd gen lentiviral vector. Cre-removable and tet/dox-controllable expression of FLAG-HA-tagged murine Dnd1 in mammalian cells.DepositorInsertDnd1 (Dnd1 Mouse)
UseCre/Lox and LentiviralTagsFLAG and HAExpressionMammalianMutationPromoterEF1alphaAvailable sinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_NRAS_p.Y64D
Plasmid#81666PurposeGateway Donor vector containing NRAS, part of the Target Accelerator Plasmid Collection.DepositorInsertNRAS (NRAS Human)
UseGateway entry vectorTagsExpressionMutationY64DPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET-Duet-ECHA(37-763) K351R-FLAG (no His-tag)
Plasmid#96888Purposeexpresses-flag tagged mouse ECHA(37-768) K351R in E.coli cells (no His-tag)DepositorInsertTrifunctional enzyme subunit alpha, mitochondrial (Hadha Mouse)
UseTagsFLAG-taggedExpressionBacterialMutationdeleted amino acid 1-36, mutated lysine 351 to ar…PromoterT7Available sinceAvailabilityAcademic Institutions and Nonprofits only -
G15-CASE
Plasmid#168126PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein G15. Composed of the subunits G alpha 15 (GNA15) tagged with NanoLuciferase, G beta 3 (GNB3) and Venus-tagged G gamma 9 (GNG9).DepositorUseLuciferaseTagscpVenus on GNG9ExpressionMammalianMutationNLuc is inserted at E244/N245 within GNA15PromoterAvailable sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Gi2-CASE
Plasmid#168121PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gi2. Composed of the subunits G alpha i2 (GNAI2) tagged with NanoLuciferase, G beta 1 (GNB1) and Venus-tagged G gamma 2 (GNG2).DepositorUseLuciferaseTagscpVenus on GNG2ExpressionMammalianMutationNLuc is inserted at C112/E115 within GNAI2PromoterAvailable sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only