We narrowed to 26,057 results for: GFP
-
Plasmid#242766PurposeAAV transfer plasmid expressing eGFP-E2 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsE2PromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-S1
Plasmid#242775PurposeAAV transfer plasmid expressing eGFP-S1 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsS1PromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRRL_miniUCOE-SFFVp-EGFP
Plasmid#244972PurposeExpress EGFP under miniUCOE-SFFV promoter. Xho I-miniUCOE-SFFVp-AgeI-EGFP.DepositorInsertminiUCOE-SFFVp-EGFP
UseLentiviralTagsEGFPExpressionMammalianPromoterSFFVAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Integrin β1β6-EGFP
Plasmid#242826PurposeEncodes human integrin β1 chimera containing integrin β6 cytoplasmic domain and C-terminal EGFP tagDepositorInsertIntegrin subunit beta 1, transcript variant 1A (ITGB1 Human)
ExpressionMammalianMutationIntegrin β1 chimera containing the cytoplasmic ta…Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV sfGFP-CHMP6 57-98
Plasmid#242420PurposeExpression of the second alpha helix of CHMP6 (residues 57-98), N-terminally tagged with sfGFPDepositorInsertCHMP6 (CHMP6 Human)
TagssfGFP (superfolder GFP)ExpressionMammalianMutationResidues 57-98PromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28(a)-p2c-eGFP
Plasmid#242758PurposeExpresses eGFP fluorophore with fused p2c targeting ligand for expression in E. coliDepositorInsertP2C-EGFP
ExpressionBacterialAvailable SinceSept. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_p300_core-dCas9-EGFP_hygro
Plasmid#226431PurposePiggyBac transposon vector containing a dox inducible p300 core-dCas9 fusion protein and EGFP reporter. Hygromycin selection markerDepositorInsertsp300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, P2A-EGFP, and p300 coreExpressionMammalianPromoterDox inducible minimal CMV and UbC PromoterAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2_Ubi_N41_R307Q CNBD AcGFP
Plasmid#241361PurposepMPS55; ubiquitously expresses cAMP sensor(cAMP-insensitive mutant control); zebrafish transgeneDepositorInsertUbi:CNBD_R307Q-AcGFP
UseTol2 zebrafish transgene expression; gatewayTagsAcGFPAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
MBP-GFP-RGG
Plasmid#242453PurposeExpresses the MBP-GFP-RGG fusion protein.DepositorInsertMBP-GFP-RGG
TagsHis and MBPExpressionBacterialPromoterT7Available SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
GST-GFP-RGG
Plasmid#242454PurposeExpresses the GST-GFP-RGG fusion protein.DepositorInsertGST-GFP-RGG
TagsGST and HisExpressionBacterialPromoterT7Available SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-Nsp3(1-111)
Plasmid#242947PurposeGFP and the Ubl1 domain of the SARS-CoV-2 Nsp3 protein (aa 1-111)DepositorAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Integrin β6β1-EGFP
Plasmid#242829PurposeEncodes human integrin β6 chimera containing integrin β1 cytoplasmic domain and C-terminal EGFP tagDepositorInsertIntegrin subunit beta 6, transcript variant 1 (ITGB6 Human)
ExpressionMammalianMutationIntegrin β6 chimera containing the cytoplasmic ta…Available SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV sfGFP-CHMP2B-3x-55-96
Plasmid#232015PurposeExpression of 3 tandem copies of CHMP2B helix 2, connected with gly-ser linkers, attached to sfGFP.DepositorInsertCHMP2B (CHMP2B Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV sfGFP-CHMP2B-55-96
Plasmid#232014PurposeExpression of CHMP2B helix 2 attached to sfGFP.DepositorInsertCHMP2B (CHMP2B Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
phSyn2 sfGFP-RNF152
Plasmid#215374PurposeLentiviral expression of sfGFP-tagged lysosome membrane protein RNF152 under the neuron-specific human synapsin promoter.DepositorInsertRNF152 (RNF152 Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-puro_T11_EGFP-Responder
Plasmid#230051PurposeIt presents the T11 inducible promoter allowing the dox-dependent inducible activation of EGFP through the OPTi-OX platformDepositorInsertT11_EGFP
ExpressionMammalianAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-puro_TRE3VG_EGFP-Responder
Plasmid#230050PurposeIt presents the TRE3VG inducible promoter allowing the dox-dependent inducible activation of EGFP through the OPTi-OX platformDepositorInsertTRE3VG_EGFP
ExpressionMammalianPromoterGAAGACAATAGCAGGCATGAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1-Pls2-sfGFP
Plasmid#205749PurposeExpresses sfGFP under IPTG inducible promoter Pls2 in high copy pTRKH2 gram-positive shuttle vector. Used in Lactobacillus gasseri. Medium/low strength.DepositorTypeEmpty backboneUseShuttle vector gram+ gram-ExpressionBacterialPromoterPls2 (Phyperspank mutant, IPTG inducible)Available SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-psfGFPcp-natMX6
Plasmid#240557PurposeTag S. pombe genes at 3' end (C-terminal end of protein) with circularly permuted superfolder GFP, codon-optimized for S. pombeDepositorInsertpsfGFPcp
ExpressionYeastAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-GFP
Plasmid#240128PurposeExpresses GFP in mammalian cellsDepositorInsertGFP
UseRetroviralExpressionMammalianAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
p-HITI-GFP-Ckm
Plasmid#226119PurposeHITI insert construct with Ckm gRNA and GFP transgeneDepositorAvailable SinceAug. 4, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFA6a-psfGFP-kanMX6
Plasmid#240551PurposeTag S. pombe genes at 3' end (C-terminal end of protein) with superfolder GFP, codon-optimized for S. pombeDepositorInsertpsfGFP
ExpressionYeastAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-psfGFPcp-hphNT1
Plasmid#240558PurposeTag S. pombe genes at 3' end (C-terminal end of protein) with circularly permuted superfolder GFP, codon-optimized for S. pombeDepositorInsertpsfGFPcp
ExpressionYeastAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-psfGFP-hphNT1
Plasmid#240552PurposeTag S. pombe genes at 3' end (C-terminal end of protein) with superfolder GFP, codon-optimized for S. pombeDepositorInsertpsfGFP
ExpressionYeastAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pStUbi7::FLS2XL-EGFP
Plasmid#239620PurposeExpress FLS2XL in planta under potato StUbi7 promoterDepositorInsertFLS2XL
TagsEGFPExpressionPlantPromoterStUbi7Available SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT-sfGFP-TurboID-ER
Plasmid#240230PurposeExpression of ER-localized sfGFP-TurboID under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertBIP-sfGFP-TurboID-KDEL
ExpressionInsectPromoterMTAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT-sfGFP-TurboID
Plasmid#240231PurposeExpression of sfGFP-TurboID under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertsfGFP-TurboID
ExpressionInsectPromoterMTAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUAS-sfGFP-TurboID-ER
Plasmid#240232PurposeExpression of ER-localized sfGFP-TurboID under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorInsertBIP-sfGFP-TurboID-KDEL
ExpressionInsectPromoterUASAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUAS-CG6867-sfGFP
Plasmid#240237PurposeExpression of CG6867-sfGFP under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWal10-roe-sfGFP
Plasmid#240239PurposeGateway destination plasmid to generate C-terminal sfGFP fusions under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorTypeEmpty backboneUseGateway destination vectorExpressionInsectAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-MYO10-BioID
Plasmid#145137PurposeExpresses EGFP-MYO10-BioID construct in mammalian cellsDepositorInsertMYO10-BioID (MYO10 Human)
ExpressionMammalianAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMC-ME_memb-EGFP-pA
Plasmid#200520PurposeMini circle middle entry plasmid for membrane GFP- pA with flanking BsaI cut sitesDepositorInsertmemb-GFP
UseMini-goldenAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-FERM (Myo10)
Plasmid#145140PurposeExpresses EGFP-tagged MyTH/FERM domains of MYO10.DepositorInsertMyTH/FERM domains of MYO10 (MYO10 Human)
ExpressionMammalianAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
CL20_MSCV-ires-GFP
Plasmid#237496PurposeRetroviral empty vectorDepositorTypeEmpty backboneUseRetroviralExpressionMammalianAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSG1016-2xBsaI-SaKKH_P2A_EGFP
Plasmid#239461PurposeCodon-optimized S. aureus KKH Cas9. 2x BsaI sites for easy cloning of varying deaminases. EGFP can serve as a transfection marker.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianPromoterCMVAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSG1039-rA1-SaKKH_P2A_EGFP
Plasmid#239462PurposeCytosine base editor with codon-optimized S. aureus KKH Cas9 and rAPOBEC1 deaminase. EGFP can be used as a transfection marker.DepositorInsertS.a. rA1 CBE
UseCRISPRTagsEGFPExpressionMammalianPromoterCMVAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tg(Sox17::EMTB-3xGFP)
Plasmid#221190PurposeTo specifically label microtubules (MTs) in Kupffer's Vesicle (KV)DepositorInsertEnsconsin Microtubule-Binding Protein (MAP7 Human)
UseZebrafishTags3 EGFPMutationMicrotubule binding-domain of ensconsin (A.A. 18…PromoterSox17Available SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Zf-GFP
Plasmid#223187PurposePlasmid containing the Zfr/eGFP cassette. Translation of GFP is controlled by splicing modulation of the Zfr by risdiplam.DepositorTypeEmpty backboneUseAAVAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-GFP
Plasmid#238041PurposeEncodes sfGFP under lac promoter. Expresses a single guide RNA (under Rha promoter), which targets a noncoding region of the plasmid as part of the ADEPT system. Carries oriT and kan resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceJune 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV CMV-d2eGFP-pA
Plasmid#233048PurposeTo express D2eGFP from a CMV promoterDepositorInsertD2GFP
UseAAVAvailable SinceJune 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_E307K
Plasmid#234560PurposeCTNNA1 butterfly eye mutantDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_L436P
Plasmid#234559PurposeCTNNA1 eye phenotype via forward genetic screenDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_R551A
Plasmid#234558PurposeCTNNA1 M2-M3 salt-bridge disrupting mutantDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
Grx1-roGFP2-PSPC1
Plasmid#236549PurposeExpressing fluorescent Grx1-roGFP2 fusion protein in mammalian cells with localization in paraspeckles.DepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-YAP-MAML2-KS
Plasmid#238276PurposeFor overexpression of mEGFP-YAP-MAML2-KSDepositorInsertmEGFP-YAP-MAML2-KS
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_EGFP-BRD4-NUT-KS
Plasmid#238255PurposeFor overexpression of EGFP-BRD4-NUT-KSDepositorInsertEGFP-BRD4-NUT-KS
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_V5-EGFP-NPM1
Plasmid#238264PurposeFor overexpression of V5-EGFP-NPM1DepositorInsertV5-EGFP-NPM1
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only