We narrowed to 6,269 results for: kit
-
Plasmid#192472PurposeStable expression of RvCAHS3 (fly codon optimized) in Drosophila cellsDepositorInsertCAHS3
UseTagsT2A-EGFP-T2A-neoRExpressionInsectMutationPromoterAc5 promoterAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSN554
Plasmid#177361PurposeExpresses human KIF1A(1-393) fused with leucine zipper, mScarlet and StrepII tagDepositorInsertKIF1A (KIF1A Human)
UseTagsLeucine zipper, StrepII tag, and mScarletExpressionBacterialMutationPromoterT7Available sinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmiRFP2-P2A-HO1-N1
Plasmid#178966PurposeExpresses miRFP2 and HO1 in mammalian cellsDepositorInsertmiRFP2-P2A-HO1
UseTagsnoExpressionMammalianMutationNOPromoterCMVAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4-GCaMP6f
Plasmid#178727PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GCaMP6f in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGCaMP6f
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-GCaMP6f
Plasmid#178729PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of GCaMP6f in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGCaMP6f
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-GCaMP6f
Plasmid#178731PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of GCaMP6f in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGCaMP6f
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS6-GCaMP6f
Plasmid#178732PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of GCaMP6f in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGCaMP6f
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-dTom
Plasmid#178716PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of dTom in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertdTom
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS2-V5-APEX2-NES
Plasmid#178702PurposeAAV vector for Cre-dependent transgene expression of V5-APEX2-NES in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertV5-APEX2-NES
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS3-V5-APEX2-NES
Plasmid#178703PurposeAAV vector for Flp-dependent transgene expression of V5-APEX2-NES in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertV5-APEX2-NES
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4-GFP
Plasmid#178709PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGFP
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-GFP
Plasmid#178710PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of GFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGFP
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-GFP
Plasmid#178711PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of GFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGFP
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD2-V5-APEX2-NES
Plasmid#178696PurposeAAV vector for Cre-dependent transgene expression of V5-APEX-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD3-V5-APEX2-NES
Plasmid#178697PurposeAAV vector for Flp-dependent transgene expression of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDON223 Spike L241-L242-A243-
Plasmid#180070PurposeSars-CoV-2 protein mutationDepositorInsertSARS-CoV-2 Spike L241-L242-A243- (S SARS-CoV-2)
UseTagsMAC-tagExpressionMammalianMutationSpike L241-L242-A243-PromoterAvailable sinceJan. 13, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTD73
Plasmid#172897PurposeIntestinal promoter ges-1P::TIR1::F2A::TagBFP2::AID* with homology arms for insertion in ttTi4348 site on chromosome IDepositorInsertTIR-1 (TIR1 Mustard Weed)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTD81
Plasmid#172902PurposeHypodermal promoter col-10P::TIR1::F2A::TagBFP2::AID* with homology arms for insertion in ttTi5605 site on chromosome IIDepositorInsertTIR-1 (TIR1 Mustard Weed)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-N entry vector
Plasmid#111751PurposeIntermediate vector containing HTT gene, except for polyQ region. Used to clone various polyQ lengths into HTT sequence with N-term FLAG tag. Baculovirus transfer vector for insect and mammalian cellsDepositorTypeEmpty backboneUseBaculovirus expressionTagsFLAGExpressionMammalianMutationPromoterAvailable sinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET24a-VHH-1xTS
Plasmid#109418PurposeBacterial expression of a functionalized anti-GFP (VHH) nanobody fused to one tyrosine sulfation (TS) motif. VHH-1xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-GFP nanobody fused to a T7, TS, HA, BAP and His6 epitope
UseTagsBAP, HA, His6, T7, and Tyrosine sulfation (TS) se…ExpressionBacterialMutationPromoterT7Available sinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MCP-dNS-SRRM1-V5-mCherry
Plasmid#235095PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein with MCP domainDepositorInsertpCAG-MCP-dNS-SRRM1-V5-mCherry (SRRM1 Human)
UseTagsExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable sinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry
Plasmid#235096PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein without MCP domainDepositorInsertpCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry (SRRM1 Human)
UseTagsExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMIG-FLAG-MLL-AF9
Plasmid#71443PurposeRetroviral construct to express FLAG-tagged MLL-AF9 fusion gene, followed by IRES-GFPDepositorInsertMLL-Af9 (KMT2A Human)
UseRetroviralTagsFLAGExpressionMammalianMutationPromoterMSCVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-CasRx-tagBFP-PGK-Blasticidin
Plasmid#187952PurposeFKBP12 (F36V mutant) degron-tagged CasRx fused with tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-CasRx-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linker, HA-tag, and NLSExpressionMammalianMutationPromoterAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMIR-FLAG-MLL-AF9
Plasmid#71444PurposeRetroviral construct to express FLAG-tagged MLL-AF9 fusion gene, followed by IRES-dsRed Express2DepositorInsertMLL-AF9 (KMT2A Human)
UseRetroviralTagsFLAGExpressionMammalianMutationPromoterMSCVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
CTCF-mAC donor (Hygro)
Plasmid#140646PurposeCTCF tagging with mAID-cloverDepositorInsertCTCF (CTCF Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
MAC-TFRC
Plasmid#172420PurposeMAC-tagged gene expressionDepositorInsertTransferrin receptor protein 1 (TfR) (CD antigen CD71) (TFRC Human)
UseTagsMAC-tagExpressionMammalianMutationPromoterCMV promoterAvailable sinceNov. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
-
pHSN6I01
Plasmid#50587PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSExpressionMutationdCas9 that is defective in DNA cleavage; the maiz…Promoter2×35Sp and AtU6-26pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHSN6A01
Plasmid#50586PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSExpressionMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…Promoter2×35Sp and AtU6-26pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA-BACH1
Plasmid#232269PurposeExpression of N-terminal tagged HA-BACH1 (H. sapiens) in human cell lines.DepositorInsertBACH1 (BACH1 Human)
UseTagsHAExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
CSII-U6-gRNA-CBh-3xFLAG-PA-dCas9-P2A-Puro
Plasmid#83306PurposeLentivirus vector to express guideRNA and dCas9 with puro resistant geneDepositorInsertsgRNA and dCas9 from pX330
UseLentiviralTagsFLAG and PA tagsExpressionMammalianMutationPromoterU6 for sgRNA and CBh for dCas9Available sinceDec. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBUN6A11
Plasmid#50579PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSExpressionMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…PromoterOsU3p and Ubi1pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only