We narrowed to 8,683 results for: sgRNA
-
Plasmid#80427PurposeU6 promoter driven sgRNA expression plasmid. Annealed oligonucleotides encoding crRNA sequence are ligated into BbsI site.DepositorTypeEmpty backboneExpressionMammalianAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pLH-stsgRNA3.1
Plasmid#64118PurposeVector for expression of St1 sgRNA3.1 in mammalian cellsDepositorInsertSt1 sgRNA3.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-OsU6c
Plasmid#66197Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterOsU6cAvailable SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-rssA
Plasmid#89957PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting rssA.DepositorInsertrssA gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pY2ShHELIX_sgRNA_entry (CJT30)
Plasmid#181781PurposeExpresses Y2-ShHELIX containing a nicking Y2 I-AniI fusion to ShTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertY2-nAniI-ShTnsB, ShTnsC, ShTniQ, ShCas12k
ExpressionBacterialMutationY2-nAniI = F13Y, S111Y, K227M, F80K, L232KPromoterLac and J23119Available SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
psgRNAv1-empty
Plasmid#171611PurposesgRNA_v1 plasmid for AsCas12f1 in bacteriaDepositorInsertAsCas12f1_sgRNA_1
ExpressionBacterialAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-OsU3m
Plasmid#66193Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterOsU3m (SpeI site destroyed)Available SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cas9-sgRNA-A+B
Plasmid#149370PurposeExpresses SpCas9 and two sgRNA targeting the lenti-CDDR reporter at two distal sitesDepositorInsertsCas9
sgRNA-A
sgRNA-B
Puromycin resistance
UseCRISPRTags3xFLAG, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianPromoterCBh, PGK, and U6Available SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-FRT
Plasmid#183241Purposeanhydrotetracycline (aTC) inducible sgRNA that targets FRT scar sites and arabinose inducible lambda RedDepositorInsertsgRNA-FRT
ExpressionBacterialPromoterP-tetAvailable SinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_Psyn-sgRNA500
Plasmid#149640Purposeparental, all-in-one CRISPRi vector for B. burgdorferi, parental for gRNA cloningDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-hEF1A-MG-U6-sgRNA
Plasmid#175505PurposeAll-in-one piggyBac transposon destination vector for hEF1a expression of Mega Gate cloned elements and hU6 expression of Golden Gate cloned guide RNAsDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionMammalianPromoterhEF1a, U6Available SinceOct. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ALDOA_sgRNA1
Plasmid#201590PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertALDOA (ALDOA Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pH-PABE-7-esgRNA
Plasmid#115620PurposeTargeted A to G in riceDepositorInsertwtTadA-TadA7.10-nCas9-3*NLS
UseCRISPRExpressionPlantAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pH-STEME-NG-esgRNA
Plasmid#138136PurposeTargeted simultaneous C-to-T and A-to-G in riceDepositorInsertAPOBEC3A-wtTadA-TadA7.10-nCas9-NG-UGI-NLS
ExpressionPlantAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEMPTY::sgRNA2
Plasmid#165459PurposeEscherichia coli – Staphylococcus aureus shuttle vector for plasmid curing in Gram-positive bacteriaDepositorInsertsgRNA2
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterSP01Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA(tyr)
Plasmid#64250Purposeexpresses sgRNA(tyr) under U6a promoterDepositorInsertU6a:sgRNA (tyr)
UseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UPP1_sgRNA2
Plasmid#201635PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUPP1 (UPP1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd6_nsgRNA(PP7)
Plasmid#232434PurposensgRNA for PE3b correction of the rd6 mutation, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3b) for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPEPZ-sgRNAclone
Plasmid#141090PurposeThis vector is designed for efficient cloning of sgRNAs by Golden Gate assembly. The sgRNA insertion leads to replacement of mCherry, resulting in loss of red color of E. coli colony.DepositorInsertmCherry
UseCRISPRExpressionBacterialPromoterp3Available SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only