We narrowed to 7,284 results for: Tet-on
-
Plasmid#240795PurposePlasmid contains the triple selection cassette gfp -pBR322ROP tetApBR322ROP - CmTrunc that allows for in vivo recombineering in E.coli.DepositorInsertSAGA pBR322ROP His medium : T7- His tags medium- gfp -pBR322ROP tetApBR322ROP - CmTrunc
UseSynthetic BiologyMutationMutation on translation initiation region of tetAAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAGA045
Plasmid#240794PurposePlasmid contains the triple selection cassette gfp -pBR322ROP tetApBR322ROP - CmTrunc that allows for in vivo recombineering in E.coli.DepositorInsertSAGA pBR322ROP His low : T7- His tags low - gfp -pBR322ROP tetApBR322ROP - CmTrunc
UseSynthetic BiologyMutationMutation on translation initiation region of tetAAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAGA043
Plasmid#240792PurposePlasmid contains the triple selection cassette gfp -p15a tetAp15a - CmTrunc that allows for in vivo recombineering in E.coli.DepositorInsertSAGA p15a His medium : T7- His tags medium- gfp -p15a tetAp15a - CmTrunc
UseSynthetic BiologyMutationMutation on translation initiation region of tetAAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAGA042
Plasmid#240791PurposePlasmid contains the triple selection cassette gfp -p15a tetAp15a - CmTrunc that allows for in vivo recombineering in E.coli.DepositorInsertSAGA p15a His low : T7- His tags low - gfp -p15a tetAp15a - CmTrunc
UseSynthetic BiologyMutationMutation on translation initiation region of tetAAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAGA040
Plasmid#240789PurposePlasmid contains the triple selection cassette gfp -RK2 tetARK2 - CmTrunc that allows for in vivo recombineering in E.coli.DepositorInsertSAGA RK2 His medium : T7- His tags medium- gfp -RK2 tetARK2 - CmTrunc
UseSynthetic BiologyMutationMutation on translation initiation region of tetAAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAGA039
Plasmid#240788PurposePlasmid contains the triple selection cassette gfp -RK2 tetARK2 - CmTrunc that allows for in vivo recombineering in E.coli.DepositorInsertSAGA RK2 His low : T7- His tags low - gfp -RK2 tetARK2 - CmTrunc
UseSynthetic BiologyMutationMutation on translation initiation region of tetAAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-Flag-H3.3
Plasmid#47980Purposetetracycline-inducible expression of human Flag tagged H3F3ADepositorInsertH3F3A (H3-3A Human)
TagsFlagExpressionMammalianMutation288 bp T to C synonymous mutationPromoterCMV promoter with tetracycline operatorAvailable SinceSept. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTrc99S-ssDsbA-TTc-4xDQNAT
Plasmid#128401PurposePeriplasmic expression of tetanus toxin fragment C with C terminal 4xDQNAT glycosylation sites in E. coliDepositorInsertTetanus toxin fragment C domain
Tags4xDQNAT glycosylation tag, 6xHis tag, and DsbA si…ExpressionBacterialPromotertrcAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTrc99S-ssDsbA-TTlight-4xDQNAT
Plasmid#128402PurposePeriplasmic expression of tetanus toxin light chain with C terminal 4xDQNAT glycosylation sites in E. coliDepositorInsertTetanus toxin light chain domain
Tags4xDQNAT glycosylation tag, 6xHis tag, and DsbA si…ExpressionBacterialMutationInactivating E234A mutationPromotertrcAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRAN357
Plasmid#120898PurposeE. coli-C. difficile shuttle vector: tetracycline-inducible promoter (Ptet) driving expression of cyan fluorescent protein (CfpOpt), multiple-cloning site for fusion to N-terminus of target proteinDepositorInsertcyan fluorescent protein, codon-optimized for low GC organisms, multiple-cloning site for protein fusion
ExpressionBacterialPromoterPtetAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
IBMc227
Plasmid#161948PurposeContains Type IIS restriction site free elements for expression vectors in IBM. Expression vector to generate ORF insertion library in IBM on TetRDepositorInsertpSB3A5*(BsaI-)-PBAD(SapI-)-tet1-TetR(1-20)-BsaI-BsaI-TetR(188-207)-Ter
ExpressionBacterialPromoterPBADAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
SunTagng22aa
Plasmid#106438PurposeEncodes a SunTag CRISPR cas9 system that does not contain a guide RNA and therefore, does not target the TET1 catalytic domain to any specific region of the genome.DepositorInsertNOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
SunTagng14aa
Plasmid#106439PurposeEncodes a SunTag CRISPR cas9 system that does not contain a guide RNA and therefore, does not target the TET1 catalytic domain to any specific region of the genome.DepositorInsertNOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN414aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
SL536
Plasmid#49942PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL539
Plasmid#49948PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceJan. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAGE2.0
Plasmid#165984PurposeMulti-host shuttle vector that can be transferred by conjugation and replicate in S. meliloti, E. coli, S. cerevisiae, and P. tricornutum. Contains S. meliloti pSymA origin and Tet resistance.DepositorInsertsRK2/RP4 origin of transfer
repA2B2C2
nourseothricin N-acetyl transferase
tetracycline resistance
UseSynthetic Biology; Bacterial and yeast cloning; c…Available SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBGE2.0
Plasmid#165987PurposeMulti-host shuttle vector that can be transferred by conjugation and replicate in S. meliloti, E. coli, S. cerevisiae, and P. tricornutum. Contains S. meliloti pSymB origin and Tet resistance.DepositorInsertsRK2/RP4 origin of transfer
repA1B1C1
nourseothricin N-acetyl transferase
tetracycline resistance
UseSynthetic Biology; Bacterial and yeast cloning; c…Available SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-TTHA
Plasmid#232479PurposeTetracycline inducible PiggyBac vector expressing bacterial TTHA1718 (TTHA) gene gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertThermus thermophilus HB8
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLY54
Plasmid#130923PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA2B2 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-LEA2B2, and PtetAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only