We narrowed to 7,580 results for: Ski;
-
Plasmid#194178PurposeExpresses MPP8-10xHis taggedDepositorAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pDONR223_TERT_p.L593F
Plasmid#82856PurposeGateway Donor vector containing TERT, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000338462
Plasmid#78158PurposeshXPO1 targeting CDSDepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR 223 VPS4B
Plasmid#169320PurposeGateway entry vector for human VPS4B ORFDepositorAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.iAChSnFR-NULL
Plasmid#137956PurposeExpresses iAChSnFR (non-binding variant) under CAG promoterDepositorArticleInsertiAChSnFR (non-binding variant)
UseAAVExpressionMammalianMutationY140A binding site mutantPromoterCAGAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR-53BP1 1-1972 28A
Plasmid#53447PurposeRecombinational donor/master vectorDepositorInsert53BP1 (TP53BP1 Human)
UseGatewayMutationI914T mutation; All 28 SQ/TQ motifs in N-term of …Available SinceDec. 10, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV hSyn syph-GFP-myc-BoNT/B(1-146)-iLID
Plasmid#122981PurposeAAV plasmid with human synapsin promoter driving synaptophysin fused to GFP, iLID(V416I) and BoNT/B amino acids 1-146. Co-express with SSPB-BoNT(147-441, Y365A) for vPA-BoNTDepositorInsertSyph-GFP-myc-BoNT/B(1-146)-iLID (Syp Rat, Synthetic)
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsinAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p21-HA-NeoR
Plasmid#215104PurposeExpresses p21-HA in mammalian cells.DepositorAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_DOK1_WT
Plasmid#82884PurposeGateway Donor vector containing DOK1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
p21-HA(dPCNA)-NeoR
Plasmid#215108PurposeExpresses p21-HA(dPCNA) in mammalian cells.DepositorInsertCDKN1A (CDKN1A Human)
TagsHAExpressionMammalianMutationp21(dPCNA) denotes mutations M147A, D149A, F150A.PromoterCMVAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6p-1_GST-DmKHC[1-421]_1xmNeonGreen
Plasmid#196974PurposeBacterial expression plasmid for GST-based purification of Drosophila melanogaster kinesin heavy chain [1-421] with C-terminal mNeonGreen tag and cleavable N-terminal GST tagDepositorAvailable SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RBM15B_WT_V5
Plasmid#83010PurposeGateway Donor vector containing RBM15B, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-hTRF1-tagRFP-T
Plasmid#103811PurposeBLInCR 'Localizer' construct that marks telomeres and is targeted by a PHR-tagged effector upon illumination with blue light; can be visualized without triggering PHR recruitmentDepositorAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_EGFR_p.D837A
Plasmid#82912PurposeGateway Donor vector containing EGFR, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_CCND1_WT
Plasmid#82891PurposeGateway Donor vector containing CCND1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBABE-NLS-HA-TurboID-PCNA
Plasmid#215074PurposeExpresses NLS-HA-TurboID-PCNA in mammalian cells from a retroviral vector.DepositorAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgRANGAP.C1-CAG-Cas9-T2A-mCherry-P2A-Puro
Plasmid#216249PurposeExpress Cas9 with CAG promoter to improve the expression in hES cells and sgRANGAP.C1 to tag endogenous RANGAP1 C-terminusDepositorInsertCas9 and sgRANGAP.C1 (RANGAP1 Human)
UseCRISPR; Endogenous taggingExpressionMammalianPromoterCAGAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_FCGR3B_WT
Plasmid#82896PurposeGateway Donor vector containing FCGR3B, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
FFSS-Cyclin D1-NeoR
Plasmid#215087PurposeExpresses FFSS-Cyclin D1 in mammalian cells.DepositorAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PIH1D1_WT_V5
Plasmid#82943PurposeGateway Donor vector containing PIH1D1, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorInsertPIH1D1 (PIH1D1 Human)
UseGateway entry vectorMutationM9L, G10E, V224I, P287LPromoterNoneAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RNH1_WT_V5
Plasmid#82995PurposeGateway Donor vector containing RNH1, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000338399
Plasmid#78156PurposeshXPO1 targeting CDSDepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_CGREF1_WT
Plasmid#82895PurposeGateway Donor vector containing CGREF1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RALA_WT_V5
Plasmid#82988PurposeGateway Donor vector containing RALA, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
t1-405
Plasmid#166127PurposeFor expression of human talin-1 head (residues 1-405) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertTln1Head (1-405) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-405 onlyAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_KEAP1_p.G524C
Plasmid#82779PurposeGateway Donor vector containing KEAP1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-HEK3-CTTins-px330-scaffold
Plasmid#180017PurposeTransiently expressing a pegRNA to introduce HEK3 CTT insertion in human cells. It has a sgRNA scaffold from px330.DepositorInsertPrime editing pegRNA for HEK3-CTTins, with px330 scaffold (EPHA8 Synthetic)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_NFIL3_WT_V5
Plasmid#82985PurposeGateway Donor vector containing NFIL3, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28a_DmKHC[1-421]-SNAP-6xHis
Plasmid#196975PurposeBacterial expression plasmid for His tag-based purification of Drosophila melanogaster kinesin heavy chain [1-421] with C-terminal SNAP tag and C-terminal 6xHis tagDepositorAvailable SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-basic-FTO promoter_WT
Plasmid#108922PurposeThe core promoter region of FTO was inserted into pGL3 basic vectorDepositorAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-FFSS-Cyclin D1 (T286A)
Plasmid#215147PurposeExpresses FFSS-Cyclin D1 (T286A) in mammalian cells from an inducible lentiviral vector.DepositorInsertCCND1 (CCND1 Human)
UseLentiviralTagsFFSS (FLAG-FLAG-STREP-STREP)ExpressionMammalianMutationWith T286A mutation.PromoterTRE3GSAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-FLEX.iAChSnFR-Venus-NULL
Plasmid#137960PurposeExpresses FLEXed iAChSnFR (non-binding yellow version) under CAG promoterDepositorArticleInsertiAChSnFR (non-binding yellow variant)
UseAAV and Cre/LoxExpressionMammalianMutationY140A binding site mutationPromoterCAGAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_CCL2_WT_V5
Plasmid#82935PurposeGateway Donor vector containing CCL2, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-RAP1A-WT-neo
Plasmid#156173PurposeLentiviral vector for expression of RAP1A-WT, with neomycin sectionDepositorInsertRAP1A (RAP1A Human)
UseLentiviralTagsnoneExpressionMammalianMutationwild type formPromoterhuman PGKAvailable SinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-basic-FTO promoter_Mut
Plasmid#108923PurposeThe core promoter region of FTO with mutant CEBPA binding sites was inserted into pGL3 basic vectorDepositorAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-HiFi-P2A-EGFP (LM446)
Plasmid#197506PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-HiFi(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-HiFi-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-HiFi(D10A/R69…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-LRRK2-G2019S-3a
Plasmid#180432PurposeTransiently expressing a pegRNA to introduce LRRK2-G2019S mutation in human cellsDepositorInsertncRNA targeting LRRK2-G2019S (LRRK2 Human)
UseCRISPRExpressionMammalianMutationLRRK2-G2019SPromoterU6Available SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQC hGAB.wt V5-His IRES G418
Plasmid#110333PurposeMammalian retroviral expression of glutaminase 2 isoform GAB (wild type) with V5 and 6xHis tagsDepositorInsertGLS2 Glutaminase 2 (GLS2 Human)
UseRetroviralTags6xHis and V5ExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_EGFR_p.T790M
Plasmid#82848PurposeGateway Donor vector containing EGFR, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only