We narrowed to 9,396 results for: CAG
-
Plasmid#193225PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch2 geneDepositorAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only
-
Lenti-sgRunx1t1#2/Cre
Plasmid#193236PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Runx1t1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTmem132d#2/Cre
Plasmid#193243PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tmem132d geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSpen#1/Cre
Plasmid#193239PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Spen geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPcdh15#1/Cre
Plasmid#193229PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Pcdh15 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSis#2/Cre
Plasmid#193238PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Sis geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSis#1/Cre
Plasmid#193237PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Sis geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch3#2/Cre
Plasmid#193228PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch3 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTsc1#1/Cre
Plasmid#193246PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tsc1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgZfp536#2/Cre
Plasmid#193249PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Zfp536 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch1#2/Cre
Plasmid#193224PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCALNL-tdTomato-2A-mSyp::EGFP
Plasmid#191213PurposeExpresses tdTomato protein and mouse Synaptophysin protein fused with EGFP in Cre expressing mammalian cells.DepositorAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-DSP
Plasmid#185549PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting DSPDepositorInsertDSP gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pv9_MBD1_MBD-R22A-13XL-BASU
Plasmid#179417PurposeCell line generation via recombination-mediated cassette exchange (RMCE) and stable expression of MBD1.MBD-R22A-13XL-BASUDepositorInsertMBD1.MBD-R22A-13XL-BASU
ExpressionMammalianPromoterCAGGSAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 exon
Plasmid#176033PurposeA vector for the CRISPR-Cas9 system targeting an exon of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pv6_CBX7_Chromo_TAF3_Phd-DW890/891AA
Plasmid#179402PurposeCell line generation via recombination-mediated cassette exchange (RMCE) and stable expression of CBX7_Chromo - TAF3_Phd(DW890/891AA)DepositorInsertCBX7_Chromo - TAF3_Phd(DW890/891AA)
TagsAviTag and EGFPExpressionMammalianMutationPhd domain DW890/891AAPromoterCAGGSAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRnf43#2/Cre
Plasmid#173614PurposeExpresses a Rnf43-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Rnf43 (Rnf43 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNcor1#1/Cre
Plasmid#173605PurposeExpresses a Ncor1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ncor1 (Ncor1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPole#1/Cre
Plasmid#173609PurposeExpresses a Pole-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pole (Pole Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsTNRC6A_1242-1709-F1359A_K
Plasmid#146742PurposeMammalian Expression of HsTNRC6A_1242-1709-F1359ADepositorInsertHsTNRC6A_1242-1709-F1359A (TNRC6A Human)
ExpressionMammalianMutationfive non silent mutations D1289G, G1515A, S1516G,…Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon5
Plasmid#177763PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon8
Plasmid#177764PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
XLone-Puro Cas13d-eGFP U6 RUNX1 g2
Plasmid#155186PurposePiggybacTransposon-based tunable and temporal expression control of Cas13d- eGFP and RUNX1 gRNA2DepositorInsertCas13d RUNX1 gRNA2
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pInducer10-UBC9-sh1
Plasmid#168986PurposeExpresses RFP cDNA and UBC9 shRNA 1 in mammalian cellsDepositorAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone3
Plasmid#162124PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
BE3-YE1
Plasmid#132943PurposeGene editing. See Gene/Insert section of plasmid page for targeting sequence cloned into this plasmid.DepositorInsertBE3-(W90Y-R126E)
UseCRISPR; Base editorExpressionMammalianMutationBE3-(W90Y-R126E)Available SinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330_gRNA_H19-DMR-1
Plasmid#159929PurposeSpecific gRNA against mouse H19-DMR cloned in the pX330 backbone (Addgene Number 42230). Deletion of H19-DMR in mouse ESC.DepositorInsertgRNA mouse H19-DMR (H19-icr Mouse)
UseCRISPR and Mouse TargetingExpressionMammalianPromoterU6, CBhAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
LB001: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#2 gRNA
Plasmid#131757PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 Sp/xCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
JV201: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#1 gRNA
Plasmid#131755PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 SaCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA FANCD2 Q223Stop
Plasmid#139332PurposePlasmid expressing a sgRNA to introduce FANCD2 Q223Stop using base editingDepositorInsertsgRNA to insert FANCD2 Q223Stop using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK3-C
Plasmid#138674PurposeExpresses a mouse SIK3-targeting sgRNA, Cas9, and Cre-recombinaseDepositorAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK1-D
Plasmid#138668PurposeExpresses a mouse SIK1-targeting sgRNA, Cas9, and Cre-recombinaseDepositorAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Blast-sgSIK1-D
Plasmid#138680PurposeExpresses a mouse SIK1-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SENP2 CCm
Plasmid#126594PurposeExpresses siRNA resistant SENP2 (coiled-coil deletion) in mammalian cells, Dox inducible in TetR cell linesDepositorInsertSENP2 (SENP2 Human)
TagsFLAGExpressionMammalianMutationDeletion of amino acids 203-228 and siRNA resista…PromoterCMVAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-AGO1 ts2
Plasmid#115851PurposeAGO1 knockdownDepositorAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Slc25a51-g1)-PGKpuroBFP-W
Plasmid#105028PurposeLentiviral gRNA plasmid targeting mouse Slc25a51 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
-
pHH0103_CASK-1/1
Plasmid#91502PurposeProtein expression and purification of human SH3 domain construct CASK-1/1DepositorInsertCASK-1/1 (CASK Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN207
Plasmid#91658PurposeExpress sgRNA targeting human REREDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN131
Plasmid#91638PurposeExpress sgRNA targeting human MAD1L1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN004
Plasmid#91618PurposeExpress sgRNA targeting human FXR1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN255
Plasmid#91584PurposeExpress sgRNA targeting human CNOT1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only