We narrowed to 3,650 results for: cmv promoter
-
Plasmid#62162PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and Puromycin module. Compatible with MultiSite Gateway cloningDepositorInsertPuromycin
UseGateway CloningExpressionMammalianPromoterCMVAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV eGFP L3-L2
Plasmid#62143PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and EGFP module. Compatible with MultiSite Gateway cloningDepositorInserteGFP
UseGateway CloningExpressionMammalianPromoterCMVAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV mCherry L5-L2
Plasmid#62146PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and mCherry module. Compatible with MultiSite Gateway cloningDepositorInsertmCherry
UseGateway CloningExpressionMammalianPromoterCMVAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV mCherry L1-R5
Plasmid#62148PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and mCherry module. Compatible with MultiSite Gateway cloningDepositorInsertmCherry
UseGateway CloningExpressionMammalianPromoterCMVAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPD1351 HBS(CMV) LumiScarlet
Plasmid#253906PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(CMV_min) promoter and LumiScarlet in the MCSDepositorInsertHBS(CMV_min) LumiScarlet
UseSynthetic BiologyTags3xFLAGExpressionMammalianPromoterHBS(CMV_min)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKG01522_pLentiX1-CMV-rtTA-betaglobin_pA
Plasmid#252549PurposeLentiviral expression of the rtTA transcriptional activatorDepositorInsertrtTA
UseLentiviralExpressionMammalianPromoterCMV (human cytomegalovirus immediate early enhanc…Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-RFP-SIKE
Plasmid#235691PurposeExpress RFP tagged SIKE gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV-zdgat2FLAG-SV40
Plasmid#232141PurposeExpresses zebrafish dgat2 with a C-terminal 3xFLAG tag under control of the CMV promoterDepositorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMCh1750_S2F-IMCg_doxy-CMV_mChe-Cdc42E7
Plasmid#118614Purposeexpression of mChe-tagged cdc42E7 under doxy-inducible CMV promoterDepositorAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV iRFP L3-L2
Plasmid#62159PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and iRFP module. Compatible with MultiSite Gateway cloningDepositorInsertiRFP
UseGateway CloningExpressionMammalianPromoterCMVAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV iRFP R4-R3
Plasmid#62158PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and iRFP module. Compatible with MultiSite Gateway cloningDepositorInsertiRFP
UseGateway CloningExpressionMammalianPromoterCMVAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-RNA-pCAG-bpNLS-miCBE-SV40NLS-bGH polyA-pCMV-mCherry-AmpR
Plasmid#248061PurposeExpression vector for expression of miCBE-ωRNA v2 driven by chicken β-actin promoter and mCherry driven by CMV promoter.DepositorInsertpU6-RNA-pCAG-bpNLS-miCBE-SV40NLS-bGH polyA-pCMV-mCherry-AmpR
UseCRISPRTagsflagExpressionMammalianMutationnonePromoterCAG, U6Available SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV GFP Puro (658-5)
Plasmid#17448Purpose3rd gen lentiviral eGFP expression vector, CMV promoter, PuroDepositorHas ServiceCloning Grade DNAInsertGFP
UseLentiviralExpressionMammalianAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Neo DEST (705-1)
Plasmid#17392Purpose3rd gen lentiviral Gateway destination vector, expression, CMV promoter, NeoDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseGateway Cloning and LentiviralExpressionMammalianAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1)
Plasmid#17452Purpose3rd gen lentiviral Gateway destination vector, expression, CMV promoter, PuroDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseGateway Cloning and LentiviralExpressionMammalianAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Blast DEST (706-1)
Plasmid#17451Purpose3rd gen lentiviral Gateway destination vector, expression, CMV promoter, BlastDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseGateway Cloning and LentiviralExpressionMammalianAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV/TO Puro DEST (670-1)
Plasmid#17293Purpose3rd gen lentiviral Gateway destination vector, expression, CMV/TO promoter, PuroDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseGateway Cloning and LentiviralExpressionMammalianAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA4-NLS(SV40) (KAC200)
Plasmid#133801PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA4 with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA4
TagsNLS(SV40)ExpressionMammalianMutationn/aPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA5-NLS(SV40) (KAC203)
Plasmid#133802PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA5 with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA5
TagsNLS(SV40)ExpressionMammalianMutationn/aPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDsRed1-CMV-Rat Npas4-DsRed1-pA
Plasmid#233272PurposeTo Express a Rat NPAS4-DsRed fusion protein from a CMV promoterDepositorAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIC3-NLS(SV40) (KAC209)
Plasmid#134341PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIC3 with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIC3
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA16_Efa-NLS(SV40) (KAC459)
Plasmid#134337PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA16_Efa with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA16_Efa
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
EK0379 CMV-TO-EGFP-stop-t70587 (PB)
Plasmid#191154PurposeExpression of Trigger 1 in the 3' UTR of EGFP in mammalian cells; used to make a cell line to study sensors for integrated 3' UTR or CDS triggers; expression is inducible with doxycycline due to CMV-TO promoter.DepositorInsertEGFP-t70587
ExpressionMammalianMutationWTPromoterCMV-TOAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA16_Lmo-NLS(SV40) (KAC508)
Plasmid#134332PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA16_Lmo with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA16_Lmo
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIC1-NLS(SV40) (KAC208)
Plasmid#134340PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIC1 with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIC1
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA17_Efa-NLS(SV40) (KAC91)
Plasmid#134333PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA17_Efa with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA17_Efa
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA17_Sga-NLS(SV40) (KAC92)
Plasmid#134334PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA17_Sga with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA17_Sga
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA18_Sma-NLS(SV40) (KAC95)
Plasmid#134335PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA18_Sma with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA18_Sma
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA19_Ssim-NLS(SV40) (KAC97)
Plasmid#134336PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA19_Ssim with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA19_Ssim
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA18_Sga-NLS(SV40) (KAC214)
Plasmid#134338PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA18_Sga with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA18_Sga
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA19_Spse-NLS(SV40) (KAC215)
Plasmid#134339PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA19_Spse with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA19_Spse
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA1-NLS(SV40) (KAC478)
Plasmid#133795PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA1 with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA1
TagsNLS(SV40)ExpressionMammalianMutationn/aPromoterCMV and T7Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 Y74E-WPRE
Plasmid#250385PurposeLentiviral expression of human NUDT5 Y74E with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 P158T-WPRE
Plasmid#250383PurposeLentiviral expression of human NUDT5 P158T with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTags2xHAExpressionMammalianMutationP158TPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 P66L-WPRE
Plasmid#250378PurposeLentiviral expression of human NUDT5 P66L with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 G150V-WPRE
Plasmid#250381PurposeLentiviral expression of human NUDT5 G150V with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTags2xHAExpressionMammalianMutationG150VPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 C76Y-WPRE
Plasmid#250379PurposeLentiviral expression of human NUDT5 C76Y with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 K175M-WPRE
Plasmid#250384PurposeLentiviral expression of human NUDT5 K175M with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTags2xHAExpressionMammalianMutationK175MPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-tagBFP-NUDT5 E112Q-WPRE
Plasmid#250376PurposeLentiviral expression of human NUDT5 carrying E112Q mutation with N-terminal tagBFP under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTagstagBFPExpressionMammalianMutationE112QPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 Y74F-WPRE
Plasmid#250380PurposeLentiviral expression of human NUDT5 Y74F with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 P158I-WPRE
Plasmid#250382PurposeLentiviral expression of human NUDT5 P158I with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTags2xHAExpressionMammalianMutationP158IPromoterCMVAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKG2438_pGEEC534_pShip-CMV-mRuby2-P2A-PuroR-bGH
Plasmid#239730PurposePlasmid expressing mRuby2 and PuroR with the CMV promoterDepositorInsertmRuby2-P2A-PuroR
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJB002 CMV 3xFLAG-NLS-DsDed-ZF1
Plasmid#161532PurposeConstitutive expression ofCMV 3xFLAG-NLS-DsDed-ZF1 under the CMV promoterDepositorInsert3xFLAG-NLS-DsDed-ZF1
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-FOXA1-T2A-eGFP
Plasmid#182337PurposeExpresses human FOXA1 and eGFP via T2A linker under control of a CMV promoter.DepositorAvailable SinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-MFSD6-Puro
Plasmid#239953PurposeLentiviral vector to generate MFSD6 stable expressing cell line under CMV promoterDepositorInsertMFSD6
UseLentiviralTagsmyc-flagExpressionMammalianAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-MFSD8-Puro
Plasmid#239954PurposeLentiviral vector to generate MFSD8 stable expressing cell line under CMV promoterDepositorInsertMFSD8
UseLentiviralTagsmyc-flagExpressionMammalianAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV/TO-miR-30 L5-L2
Plasmid#62123PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a tet-inducible CMV promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseGateway Cloning and RNAiExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV Puro DEST p38KTRmCerulean3
Plasmid#59155PurposeLentiviral vector to express p38 KTR mCerulean3 under CMV promoter (With Puromycin Resistance)DepositorInsertp38 Kinase Translocation Reporter (MAPK14 Mouse, Human)
UseLentiviralTagsmCerulean3ExpressionMammalianPromoterCMVAvailable SinceSept. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
Lenti-Dual-iCas9-CMV
Plasmid#167500PurposeExpression of dual inducible Cas9 with CMV promoterDepositorInsertCas9
UseCRISPR, Lentiviral, and LuciferaseTagsFLAGExpressionMammalianPromoterCMVAvailable SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only