59,508 results
-
Plasmid#180457PurposeE. coli expression of class I MHC light chainDepositorInsertHuman beta-2 microglobulin
ExpressionBacterialAvailable SinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSCB-hDot1Lwt
Plasmid#74173PurposeFor packaging hDot1Lwt to retrovirus.DepositorAvailable SinceMay 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
BcatMutS33/S37.T41/S45
Plasmid#24204DepositorInsertbeta catenin (CTNNB1 Human)
TagsFLAGExpressionMammalianMutationS33A, S37A, T41A,S45APromoterCMVAvailable SinceMarch 9, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-CRBN-pGK-HYG
Plasmid#107380PurposeMammalian expression of FLAG-CRBNDepositorAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK5-p18-HA
Plasmid#42338DepositorAvailable SinceMarch 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
LEGO-pDHS-ITDE-AP1x6-DUSP5
Plasmid#217419PurposeLuciferase expression vector with an oncogene-inducible enhancer, 6 AP-1 sites, the full length DUSP5 promoter, and a chromatin priming element. Alias: LEGO-DUSP5p-AP-1x6-ITDeDepositorInsertLuciferase, GFP
UseLentiviral and LuciferaseExpressionMammalianPromoterHuman DUSP5 promoterAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB_eCB2.0-IRES-mCherry-CAAX
Plasmid#164611PurposeExpress the endocannabinoid sensor GRAB_eCB2.0 in mammalian cellsDepositorInsertEndocannabinoid sensor GRAB_eCB2.0
ExpressionMammalianMutationS383TPromoterCMVAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-LMNB1
Plasmid#207770PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of LMNB1 for knock-in.DepositorInsertsgRNA Targeting N-terminus of LMNB1 (LMNB1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tet-off TauRD (P301L/V337M)
Plasmid#188572PurposeDox-repressible expression of the Tau repeat domainDepositorInsertTau repeat domain (MAPT Human)
UseLentiviralTagsMycExpressionMammalianMutationP301L and V337MPromoterpTight TREAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma10-GFP2
Plasmid#166779PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma10-GFP2 (GNG10 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
sFlt1-i13 V5
Plasmid#86044Purposehuman Soluble Flt1 isoform i13 (terminates in intron 13)DepositorInserthuman soluble Flt1 isoform i13 (FLT1 Human)
Tags6xHis and V5ExpressionMammalianMutationisoform i13 (terminates in intron 13)PromoterCMVAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
WT USP7 catalytic
Plasmid#227201PurposeExpresses human USP7 Catalytic domain with a N-terminal cleavable 6His tag in E. coliDepositorInsertUSP7 (Ubiquitin carboxyl-terminal hydrolase 7) (USP7 Human)
Tags6HisExpressionBacterialMutationaa 207-560PromoterT7-promoterAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-ERP2-(N-HA)KRAS_G12D
Plasmid#201254PurposeDox-inducible overexpression of HA-tagged KRASG12D and mCherry in human cellsDepositorInsertKRAS (KRAS Human)
UsePiggybac transposonTagsHA-TagExpressionMammalianMutationchanged Gly (G) 12 to Asp (D)PromoterTREAvailable SinceSept. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF3164
Plasmid#144640PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
NW9
Plasmid#133442PurposeCovalently circularized nanodisc NW9 for studying membrane proteins and viral entry.DepositorInsertNW9
ExpressionBacterialAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
PGKp-GFP-YAP (5SA)
Plasmid#174174PurposeLentiviral vector to constitutively express overactive YAP (5 LATS phosporylation sites mutated to Ala) under control of the human PGK promoter.DepositorInsertYAP (YAP1 Human)
UseLentiviralTags3x FLAG tagExpressionMammalianMutationFive LATS phosphorylation sites (S61, S109, S127,…PromoterPGKAvailable SinceAug. 19, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Hs.HRAS G12V
Plasmid#83184PurposeGateway ORF Entry clone of human HRAS [NM_005343.2 ] with stop codon (for native or N-terminal fusions), G12V mutationDepositorAvailable SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAc-GFPC1-Sec61beta
Plasmid#15108DepositorAvailable SinceJune 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
NES-EGFP-PH-ARNO2G-I303Ex2
Plasmid#116868PurposePIP3 biosensorDepositorInsertCYTH2 (CYTH2 Human)
TagsEGFP and X.leavis map2k1.L(32-44)ExpressionMammalianMutationamind acids 252-399, isoleucine 303 changed to gl…Available SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only