We narrowed to 11,153 results for: streptococcus -(crispr) -(cas9)
-
Plasmid#98411PurposePombe Expression Vector - nmt1 promoter with Sp.ura4 markerDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pX52
Plasmid#169444PurposeUsed for guide cloning with PCRDepositorTypeEmpty backboneUseCRISPRAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYTK-DN3
Plasmid#180284PurposeSpacer cassette (TU2)DepositorInsertConL1 - Spacer - ConR2
ExpressionBacterialAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pROS15
Plasmid#107929Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL12
Plasmid#107918Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP13-AAV-H1/TO-L-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82703PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR
Plasmid#68345PurposeA Sleeping beauty transposon with conditional expressed hCas9. A red flourescent gene linked to puromycin can be removed in the prescence of Flp recombinase allowing Cas9 expressionDepositorInsertspuromycin
hCas9
UseCRISPR; Flp/frtTagslinked to red flouresent protein gene mKateII and…ExpressionMammalianPromoterCAGAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9N863Anickase.EF1a-BFP.sgLMNApair1
Plasmid#98976PurposeCas9 Homologous Recombination Reporter. SpCas9N863A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 44bp 3' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 1 and Cas9(N863A)
ExpressionMammalianAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair1
Plasmid#98972PurposeCas9 Homologous Recombination Reporter. SpCas9D10A nickase and a pair of sgRNA targeting hLMNA. Generates breaks with 44bp 5' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 1 and Cas9(D10A)
ExpressionMammalianAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAPIC-soma-AcrIIA4
Plasmid#250802PurposeDrosophila transgenic vector: To make tub-AcrIIA4 with piRNA targeting sequence in the 3'UTR; to suppress Cas9 activity in somatic tissues but not in the germlineDepositorInsertAcrIIA4
ExpressionInsectAvailable SinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAPIC-nos-AcrIIA4
Plasmid#250801PurposeDrosophila transgenic vector: To express AcrIIA4 driven by nos transcription regulatory sequences (promoter, 5'UTR, 3'UTR and polyA); to suppress Cas9 activity in the germlineDepositorInsertAcrIIA4
ExpressionInsectAvailable SinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag VP64 gRNA17 (FWA)
Plasmid#120250PurposeCRISPR-Cas9 SunTag system to target VP64 to the FWA locus with a single guide RNADepositorInsertg17_U6_NOS_NLS_GB1_NLS_linker_VP64_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
Cas9m2-VP64
Plasmid#47317PurposeCas9m2 ActivatorDepositorInsertCas9m2-VP64
UseCRISPRAvailable SinceAug. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDD372
Plasmid#91824PurposeCodon-optimized GFP donor for the SapTrap cloning systemDepositorInsertGFP-C1
UseCRISPRExpressionWormAvailable SinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHFS:SEP-rGluA2 TKIT donor
Plasmid#169440PurposeDonor DNA for TKIT knockin of SEP to GluA2 in ratDepositorInsertSuper ecliptic pHluorin (SEP)
UseCRISPRExpressionMammalianAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRAU171
Plasmid#86835Purposebacterial expression of anti-CRISPR protein AcrIIA2DepositorInsertacrIIA2
ExpressionBacterialPromoteraraBADAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSC38
Plasmid#104812PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr3g107390 (MtRdr6). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertMedtr3g107390
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUDR418
Plasmid#113875Purposeexpression of double Cas9 programming sgRNA11 targetting STL1DepositorInsertdoble sgRNA11-STL1
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB6681
Plasmid#106157PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6637, integration into Yarrowia lipolytica chromosomal location IntE_3, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only